User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare

Jump to: navigation, search
Name Sequence Characteristics Probe set number
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] 1
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster 14
cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster 14
cluster-p AAATTCGACCCGGCTGTCGC qPCR for GATC-cluster 14
761139p CCAGGAAGCCCACGGATTCG
761139fw GAGATCCTGCCGATGATGTA
761139rv TTCCAGCAACTCTTTGATCG
797735fw CGTCCTGGCGTATCGTATC
797735rv GCATTGTAAGAACCTACAAAGACAA
797735p TTTGCCGCAGAGTCTGCGCT
1504230fw CGCCTTCAGTTTATGATCCA
1504230rv TCGAGAAGTGTTCAAAGCAGA
1504230p TGATCACCATCGCCTGCTGTTG
1514191fw ATACTGTTTGGCAGAGGCAA
1514191rv GGTATGGCTGATGATGTGCT
1514191p TGACCGGTCAGCGGATCACC
2318305fw ATAATCACCTACGCGCCTTC
2318305rv ACCTGCCTGCCTGAATAAAC
2318305p TGCCGCAGATCACCCTGGTC
2351285fw ACACATTGCCGAATATGCC
2351285rv GTTAATGCGGTGATCCATGA
2351285p CTGCGCATTCGCATGTTCCC


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935. PubMed HubMed [Yamazoe-2005]
Personal tools