User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare

Jump to: navigation, search
Name Sequence Characteristics Probe set number
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] 1
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster 14
cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster 14
cluster-p AAATTCGACCCGGCTGTCGC qPCR for GATC-cluster 14
761139p CCAGGAAGCCCACGGATTCG 6
761139fw GAGATCCTGCCGATGATGTA 6
761139rv TTCCAGCAACTCTTTGATCG 6
797735fw CGTCCTGGCGTATCGTATC 4
797735rv GCATTGTAAGAACCTACAAAGACAA 4
797735p TTTGCCGCAGAGTCTGCGCT 4
1504230fw CGCCTTCAGTTTATGATCCA 13
1504230rv TCGAGAAGTGTTCAAAGCAGA 13
1504230p TGATCACCATCGCCTGCTGTTG 13
1514191fw ATACTGTTTGGCAGAGGCAA 12
1514191rv GGTATGGCTGATGATGTGCT 12
1514191p TGACCGGTCAGCGGATCACC 12
2318305fw ATAATCACCTACGCGCCTTC 5
2318305rv ACCTGCCTGCCTGAATAAAC 5
2318305p TGCCGCAGATCACCCTGGTC 5
2351285fw ACACATTGCCGAATATGCC 16
2351285rv GTTAATGCGGTGATCCATGA 16
2351285p CTGCGCATTCGCATGTTCCC 16
2923803fw GTCAGCCACCTGCTGAAAT 15
2923803rv ATACTGAATTTGGAGCGAACC 15
2923803p TGCCTGATCACCCATCAACCAGA 15
2952960fw CTACTGTTTCGCGGATCTCA 8
2952960rv CAACTGCTTGCAGAACCATT 8
2952960p CTGGTGATCACCCGCGCATT 8
3923874fw GCCCTGTGGATAACAAGGAT 18
3923874rv CCTCATTCTGATCCCAGCTT 18
3923874p CGGTCCAGGATCACCGATCATTC 18
3921366fw GAGAATATGGCGTACCAGCA 7
3921366rv AAGACGCAGGTATTTCGCTT 7
3921366p CAACCTGACTTCGGTCCGCG 7
4301774fw CTGAATAACTCGCCTCGTGA 10
4301774rv ATTCCCGTCTTCATGGTTTC 10
4301774p TAAGCGCCGATCACCGGGAT 10
4321507fw AGCCAGAGGTGGAGTTAGGA 9
4321507rv ACAACCTGAACGATCTGCTG 9
4321507p TCTCACCTTTGGCAATGGCGA 9
ter-fw TCCTCGCTGTTTGTCATCTT 17
ter-rv GGTCTTGCTCGAATCCCTT 17
ter-p CATCAGCACCCACGCAGCAA 17


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935. PubMed HubMed [Yamazoe-2005]
Personal tools