User:Torsten Waldminghaus/qPCR-Primers
From OpenWetWare
Jump to navigationJump to search
- All primers are in concentrations of 100pmol/μL
Name | Sequence | Characteristics | Probe set number |
---|---|---|---|
uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | 1 |
uvrDrv | GTCAGCGTCAGTTTCTGCAT | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | 1 |
uvrDprobe | AGACGCCCGCCTTCATCCAG | HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] | 1 |
yahEFfw | CCATCGAGACGATCAAAGAA | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
yahEFrv | CAGCATCTGGCTTTGTTGTT | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
yahEFprobe | AACTCGCGTCCTTCGGCAGC | HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
cluster-fw | CTGACTGATGAGATCCAACGA | qPCR for GATC-cluster | 14 |
cluster-rv | CTGGTGCTACGCCTGAATAA | qPCR for GATC-cluster | 14 |
cluster-p | AAATTCGACCCGGCTGTCGC | HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster | 14 |
761139p | CCAGGAAGCCCACGGATTCG | HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
761139fw | GAGATCCTGCCGATGATGTA | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
761139rv | TTCCAGCAACTCTTTGATCG | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
797735fw | CGTCCTGGCGTATCGTATC | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
797735rv | GCATTGTAAGAACCTACAAAGACAA | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
797735p | TTTGCCGCAGAGTCTGCGCT | HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
1504230fw | CGCCTTCAGTTTATGATCCA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
1504230rv | TCGAGAAGTGTTCAAAGCAGA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
1504230p | TGATCACCATCGCCTGCTGTTG | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
1514191fw | ATACTGTTTGGCAGAGGCAA | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
1514191rv | GGTATGGCTGATGATGTGCT | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
1514191p | TGACCGGTCAGCGGATCACC | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
2318305fw | ATAATCACCTACGCGCCTTC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
2318305rv | ACCTGCCTGCCTGAATAAAC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
2318305p | TGCCGCAGATCACCCTGGTC | HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
2351285fw | ACACATTGCCGAATATGCC | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
2351285rv | GTTAATGCGGTGATCCATGA | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
2351285p | CTGCGCATTCGCATGTTCCC | HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
2923803fw | GTCAGCCACCTGCTGAAAT | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
2923803rv | ATACTGAATTTGGAGCGAACC | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
2923803p | TGCCTGATCACCCATCAACCAGA | HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
2952960fw | CTACTGTTTCGCGGATCTCA | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
2952960rv | CAACTGCTTGCAGAACCATT | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
2952960p | CTGGTGATCACCCGCGCATT | HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
3923874fw | GCCCTGTGGATAACAAGGAT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
3923874rv | CCTCATTCTGATCCCAGCTT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
3923874p | CGGTCCAGGATCACCGATCATTC | HPLC-pure 5'Fam - 3'Tamra qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
3921366fw | GAGAATATGGCGTACCAGCA | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
3921366rv | AAGACGCAGGTATTTCGCTT | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
3921366p | CAACCTGACTTCGGTCCGCG | HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
4301774fw | CTGAATAACTCGCCTCGTGA | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
4301774rv | ATTCCCGTCTTCATGGTTTC | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
4301774p | TAAGCGCCGATCACCGGGAT | HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
4321507fw | AGCCAGAGGTGGAGTTAGGA | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
4321507rv | ACAACCTGAACGATCTGCTG | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
4321507p | TCTCACCTTTGGCAATGGCGA | HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
ter-fw | TCCTCGCTGTTTGTCATCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
ter-rv | GGTCTTGCTCGAATCCCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
ter-p | CATCAGCACCCACGCAGCAA | HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
datA-fw | CAAGCTGTGGATGAATCAGG | qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 19 |
datA-rv | AAATGCGTGCATAGTCGAAG | qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 19 |
datA-p | CAATCACCCGAACCAGACGCTG | qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 19 |