User:Torsten Waldminghaus/qPCR-Primers
From OpenWetWare
- All primers are in concentrations of 100pmol/μL
| Name | Sequence | Characteristics | Probe set number |
|---|---|---|---|
| uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) | 1 |
| uvrDrv | GTCAGCGTCAGTTTCTGCAT | qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) | 1 |
| uvrDprobe | AGACGCCCGCCTTCATCCAG | HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis); chrom. position at bp 337400 | 1 |
| yahEFfw | CCATCGAGACGATCAAAGAA | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]); chrom. position at bp 337400 | 2 |
| yahEFrv | CAGCATCTGGCTTTGTTGTT | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]); chrom. position at bp 337400 | 2 |
| yahEFprobe | AACTCGCGTCCTTCGGCAGC | HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
| cluster-fw | CTGACTGATGAGATCCAACGA | qPCR for GATC-cluster | 14 |
| cluster-rv | CTGGTGCTACGCCTGAATAA | qPCR for GATC-cluster | 14 |
| cluster-p | AAATTCGACCCGGCTGTCGC | HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster | 14 |
| 761139p | CCAGGAAGCCCACGGATTCG | HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 761139fw | GAGATCCTGCCGATGATGTA | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 761139rv | TTCCAGCAACTCTTTGATCG | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 797735fw | CGTCCTGGCGTATCGTATC | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 797735rv | GCATTGTAAGAACCTACAAAGACAA | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 797735p | TTTGCCGCAGAGTCTGCGCT | HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 1504230fw | CGCCTTCAGTTTATGATCCA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1504230rv | TCGAGAAGTGTTCAAAGCAGA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1504230p | TGATCACCATCGCCTGCTGTTG | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1514191fw | ATACTGTTTGGCAGAGGCAA | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 1514191rv | GGTATGGCTGATGATGTGCT | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 1514191p | TGACCGGTCAGCGGATCACC | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 2318305fw | ATAATCACCTACGCGCCTTC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2318305rv | ACCTGCCTGCCTGAATAAAC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2318305p | TGCCGCAGATCACCCTGGTC | HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2351285fw | ACACATTGCCGAATATGCC | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2351285rv | GTTAATGCGGTGATCCATGA | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2351285p | CTGCGCATTCGCATGTTCCC | HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2923803fw | GTCAGCCACCTGCTGAAAT | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2923803rv | ATACTGAATTTGGAGCGAACC | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2923803p | TGCCTGATCACCCATCAACCAGA | HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2952960fw | CTACTGTTTCGCGGATCTCA | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 2952960rv | CAACTGCTTGCAGAACCATT | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 2952960p | CTGGTGATCACCCGCGCATT | HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 3923874fw | GCCCTGTGGATAACAAGGAT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3923874rv | CCTCATTCTGATCCCAGCTT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3923874p | CGGTCCAGGATCACCGATCATTC | HPLC-pure 5'Fam - 3'Tamra qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3921366fw | GAGAATATGGCGTACCAGCA | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 3921366rv | AAGACGCAGGTATTTCGCTT | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 3921366p | CAACCTGACTTCGGTCCGCG | HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 4301774fw | CTGAATAACTCGCCTCGTGA | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4301774rv | ATTCCCGTCTTCATGGTTTC | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4301774p | TAAGCGCCGATCACCGGGAT | HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4321507fw | AGCCAGAGGTGGAGTTAGGA | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| 4321507rv | ACAACCTGAACGATCTGCTG | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| 4321507p | TCTCACCTTTGGCAATGGCGA | HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| ter-fw | TCCTCGCTGTTTGTCATCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| ter-rv | GGTCTTGCTCGAATCCCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| ter-p | CATCAGCACCCACGCAGCAA | HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| datA-fw | CAAGCTGTGGATGAATCAGG | qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 3 |
| datA-rv | AAATGCGTGCATAGTCGAAG | qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 3 |
| datA-p | CAATCACCCGAACCAGACGCTG | HPLC-pure 5'Fam - 3'Tamra qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 3 |
| ori1fw | AGATCAGCGTTGTCTTCACG | qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961. Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 19 |
| ori1rv | CCATGGGCACTAAAGAACCT | qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 19 |
| ori1Probe | TTCCGCACGCGAAGTGAACA | HPLC-pure 5'Fam - 3'Tamra qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 19 |
| ter1Rfw | GCTATGGTGGAAGCACAAGA | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 21 |
| ter1Rrv | CTCGTTCAAAGTCCGCTTG | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 21 |
| ter1Rprobe | TGCGCTTTCACACGCTGCTC | HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 21 |
| ori2fw | CCTTGAGCTTGAGATTGCTG | qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 20 |
| ori2rv | GCCGCCCTACTATCGTTAAA | qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) | 20 |
| ori2probe | TGCTCACGCTGAGCCTCATTCA | HPLC 5'Fam - 3'Tamra qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) | 20 |
| ter2Rfw | CCAAAGTGCAACCGACTAAA | qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 22 |
| ter2Rrv | ACGGCTAAACCAACCAGTTT | qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) | 22 |
| ter2Rprobe | TCGGCTCTGGCTCTTTCTTCTGC | HPLC 5'Fam - 3'Tamra qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) | 22 |
| ter1Cfw | CACATACACGCAAACCACAA | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 23 |
| ter1Crv | CTTACAGAAGCACGCCATTC | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) | 23 |
| ter1Cprobe | CCAGCCGCAATCTTGCCAAA | HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) | 23 |
| ter2Cfw | AGTTCGGTGAGATTGGCATT | qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 24 |
| ter2Crv | CGGTACTTCTTTGATCATCGC | qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) | 24 |
| ter2Cprobe | CCCTGCTCGCTCATGATGGC | HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) | 24 |
| oriOpenfw | CAACTTTGTCGGCTTGAGAA | qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest | 25 |
| oriOpenrv | TGATCCTTTCCAGGTTGTTG | qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest | 25 |
| oriOpenprobe | TCCACAGGGCAGTGCGATCC | HPLC5'Fam - 3'Tamra qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest | 25 |
| 2728013fw | CGCAACCCTTATCCTTTGTT | qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments | 11 |
| 2728013rv | TAAGGGCCATGATGACTTGA | qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments | 11 |
| 2728013probe | CTCCTTTGAGTTCCCGGCCG | HPLC5'Fam - 3'Tamra qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments | 11 |
| ibpAqPCRfw | AGGTAGCCAGAACACCCATC | qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP | 27 |
| ibpAqPCRrv | AAGTCCGCTGATAAGGCTTG | qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP | 27 |
| ibpAqPCRprobe | CGCGTCCTCATCGGCTACGA | HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP | 27 |
| rpsDfw | AAGTTGATGCTGGCAAGATG | qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome | 28 |
| rpsDrv | TAAAGCTCGACGATCAGGTG | qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome | 28 |
| rpsDprobe | TCAGAACGCTCCGGCTTACGC | 5'Fam - 3'Tamra qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome | 28 |
| recNfw | TTACGCCAGCCTCTTTACTG | qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) | 26 |
| recNrv | AGCTCACGAACGATAGCAAA | qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) | 26 |
| recNprobe | TTGGCACAACTGACCATCAGCAA | 5'Fam - 3'Tamra qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) | 26 |
| ori1fw_new | AATCCGTGGAGAAGATCTGG | qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers | 29 |
| ori1rv_new | CCATGCTGGTTGAGAATACG | qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers | 29 |
| ori1probe_new | TCTTCCGCACGACGTTTGGC | 5'Fam - 3'Tamra qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers | 29 |
| ORIqPCRfw | TTGATCCAAGCTTCCTGACA | qPCR primer for analysis of oriC in E. coli | 30 |
| ORIqPCRrv | GGCGAAACACTGAAGATCAA | qPCR primer for analysis of oriC in E. coli | 30 |
| ORIqPCRprobe | CCCAGCCATTCTTCTGCCGG | 5'Fam - 3'Tamra qPCR primer for analysis of oriC in E. coli | 30 |
| AToriCir_fw | TACGCACCTGTGGACAATCT | qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91 | |
| AToriCir_rv | AAGTGGCGTCTCTCGTCTTC | qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91 | |
| AToriCir_p | CCGTCTTATTCCAGTAATTCACAGGCG | 5'Fam - 3'Tamra qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91 | |
| ATterCir_fw | GATGGGTCAGCACATGATTG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81 | |
| ATterCir_rv | ACGCCATCCTGATCGAAG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81 | |
| ATterCir_p | CGACGCTCGCCTTCCGTTTC | 5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81 | |
| ATterLin_fw | ATGCTTCATGAGCTTTCGTG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65 | |
| ATterLin_rv | CAACGATACAGTTCCCGATG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65 | |
| ATterLin_p | TTCCAGCCATGTTGCGAGGC | 5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65 | |
| AToriLin_fw | GTACATTAACGCTGCTTCGG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89 | |
| AToriLin_rv | TTGCATTAACCATAGGAAGCC | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89 | |
| AToriLin_p | CCGCCTTAAGCGAATCTTGCG | 5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89 |
- Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935.
- Rasmussen T, Jensen RB, and Skovgaard O. . pmid:17557077.
- Srivastava P and Chattoraj DK. . pmid:17944831.


