User:Wilfred J. Poppinga/Notebook/cAMP compartmentalization/2010/07/01: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 119: Line 119:
*Solaris qPCR Gene Expression Master Mix (2x) (ROX)
*Solaris qPCR Gene Expression Master Mix (2x) (ROX)
*qPCR cycler (ABI StepOne)
*qPCR cycler (ABI StepOne)
*MicroAmp™ Fast optical 48-well reaction plate (0.1 mL) (Applied Biosystems)
=====Primer=====
=====Primer=====
*Primer AKAP9 ([http://www.dharmacon.com/CatalogSearch/ConsolidatedSearch.aspx?searchTerm=AKAP450&searchTarget=10142_+AKAP9 Dharmacon Inc.]
*Primer AKAP9 ([http://www.dharmacon.com/CatalogSearch/ConsolidatedSearch.aspx?searchTerm=AKAP450&searchTarget=10142_+AKAP9 Dharmacon Inc.]

Revision as of 09:36, 2 July 2010

<html><style type="text/css"> .todo { color: red } .done { color: green} </style></html>

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Summary

Materials & Methods

Method

Bradford

  • Bradford performed by Tina
    • 5,05 mg/mL protein in Lysis buffer
    • 4,02 mg/mL protein in HeLa -S sample

SDS-PAGE

  • 8% SDS-PAGE
  • preparation of cDNA and qPCR
Gel loading hTERT D9 + HEK293 see codes 21June2010
# 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Gel
cAMP prec. 		X X Invitrogen Marker
(8 μL) 		HeLa -S
(20 μL) 		HEK293
(20 μL) 		Biorad Marker
(8 μL) 		C1
(20 μL) 		C2
(20 μL) 		C3
(20 μL) 		S1
(20 μL) 		S2
(20 μL) 		S3
(20 μL) 		X X X
Coomassie staining
  • As described 25June2010
    • For silver staining fix again in 40% Ethanol/10% acetic acid (2x 10-30 min) & 10% EtOH/5% acetic acid (2x 10 min)
Silver staining
  • FIXING (see above when following Coomassie staining)

1. Fix gel for 2 h in fixing solution (30% ethanol (v/v) & 10% acetic acid (v/v)) 2. Wash gel 2x 10 min. with 250 mL 10% 30 Ethanol (v/v) 3. Wash gel 3x 10 min. with dH2O 10 min. OPTIONAL a. Soak for 10 min in 3.4 mM potassium dichromate-0.0032 N nitric acid (200 ml/gel, 25°C) (stronger signal) b. Wash with deionized water three times for 10 min (400 ml/gel, 25°C). STAINING 4. Incubate gel 30 min. in 200 mL 0.1% Silvernitrate solution (w/v) 5. Rinse 3x 5 min. with dH2O DEVELOPING 6. Develop gel for 5 – 10 min. in 200 mL 3% NaCO3 + 200 uL 37% Formaldehyde solution 7. Stop development with 200 mL 1~5% Acetic acid for 5~10 min. 8. Wash gel with dH2O (2 min.) DESTAINING 9. Destain with (Farmer’s reducer, will clear whole gel!) a. 50 mL 2% Potassium hexacyanoferrate(III) (C6N6FeK3) b. 50 mL 3% sodiumthiosulphate (Na2S2O3) 10. Wash 3x 10 min. with dH2O (RESTAINING) (Drying the gel, gel can be soaked in drying solution (10% glycerol + 15% EtOH) for 30 min. and let to dry

qPCR

Preparing cDNA
  • SuperScript® III First-Strand Synthesis SuperMix for qRT-PCR (Invitrogen)
    • Incl. SuperScript® III Reverse Transcriptase (Invitrogen) (DRAWER #5)

The following procedure is designed to convert 1 pg to 5 μg of total RNA or 1 pg to 500 ng of poly(A)+ RNA into first-strand cDNA:

  • Mix and briefly centrifuge each component before use.
  • Combine the following in a 0.2- or 0.5-ml tube:
Component Amount
up to 5 μg total RNA (1 μg) n μl
50 ng/μl random hexamers 1 μl
Annealing buffer 1 μl
RNase/DNase-free water 8 μl
  • Incubate at 65°C for 5 min (progr. ALI), and then immediately place on ice for at least 1 minute. Collect the contents of the tube by brief centrifugation.
  • Add the following to the tube on ice:
    • 2X First-Strand Reaction Mix 10 μl
    • SuperScript™ III/RNaseOUT™ Enzyme Mix 2 μl
  • Vortex the sample briefly to mix, and collect by brief centrifugation (1 min. 1000rcf). Incubate as follows:
    • Random hexamer primed: 5-10 min at 25°C, followed by 50 min at 50°C (Progr. VANN)
  • Collect the reactions by brief centrifugation
  • cDNA synthesis reaction can be stored at -20°C or used for PCR immediately
Real time qPCR
  • Thermo Scientific Solaris qPCR Gene Expression Assay
    • Two primers at 800 nM + one probe 200 nM = primer probe set (20x)
  • Solaris qPCR Gene Expression Master Mix (2x) (ROX)
  • qPCR cycler (ABI StepOne)
  • MicroAmp™ Fast optical 48-well reaction plate (0.1 mL) (Applied Biosystems)
Primer
  • Primer AKAP9 (Dharmacon Inc.
    • FW: AACCTGAAGATGTGCCTCCTG
    • REV: CTGGAGTGCATACCTTTC
    • Probe: GATTTTGTCTAATGAAA
  • AKAP12 (Dharmacon Inc.
    • FW CAAGCACAGGAGGAGTTACAG
    • REV CTGGTCTTCCAAACAGACAATG
    • Probe ATCATGCAGTTAAACTCA
  1. Thaw reagents on ice, mix (DO NOT VORTEX) and spin down
  2. Mix
    • Solaris qPCR Master mix (2x) 12.5 μL
    • Solaris primer/probe set (20x) 1.25 μL
    • Water (PCR Grade) 9.25 μL
    • cDNA 2 μL
    • Total volume 25 μL
  1. Seal with optical clear seals and briefly centrifuge (removing bubbles)
  2. Run on thermal cycler (ABI StepOne)
' Temperature Time Number of cycles
Enzyme activation 95 °C 15 min 1
Denaturation 95 °C 15 sec 40
Annealing/Extension 60 °C 60 sec
  1. Data is collected during the last 40 cycles
48-wells plate
# 01 02 03 04 05 06 07 08
A
B
C
D
E
F

Notes

  • Dilution of RNA for preparation of cDNA
RNA H2O
S1 1,97 4,03
S2 2,42 3,58
S3 1,49 4,51
C1 1,64 4,36
C2 2,18 3,82
C3 1,57 4,43

Results

  • Coomassie staining

Discussion

  • DONE Ow..

Related

Related entries

Same actions

Related topics

Attachment

<html> <a href="http://openwetware.org/wiki/Image:Bradford_01072010.xls"> 

  <img src="http://openwetware.org/images/f/f8/Owwnotebook_icon.png" alt="" width="50" height="50">

</a> </html> Bradford results, slightly different than those calculated by Tina

<html> <a href="http://openwetware.org/wiki/Image:HTERT_Donor_12_ht31_160310.xls"> 

  <img src="http://openwetware.org/images/f/f8/Owwnotebook_icon.png" alt="" width="50" height="50">

</a> </html> Excel TITLE


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Wilfred_J._Poppinga/Notebook/cAMP_compartmentalization/2010/07/01&oldid=429260"