|
|
(3 intermediate revisions by 2 users not shown) |
Line 1: |
Line 1: |
| ==Pages to review:==
| | *'''[[User:Reshma P. Shetty|Reshma]] 16:52, 29 November 2007 (CST)''': Hey Darek, Thanks for your note. I totally agree with your comments regarding the pros and cons of a credits or author section. A few of us on OWW have had the same debate ourselves. We've talked about having "Curators" in the hopes that the term curator would still allow someone to take credit for their work but not discourage contributions. See [[DNA ligation]] for an example. But I am not sure that idea works great either. Also, on another note, I quickly created a page called [[Wikiomics]] to aggregate all the Wikiomics pages and recent changes in one place. Feel free to amend or change it or make it look better. I just thought it might be nice to have a "central" page for the Wikiomics pages. |
| * http://www.bioalgorithms.info/slides.php | | *'''[[User:Reshma P. Shetty|Reshma]] 12:06, 26 November 2007 (CST)''': Hey Darek, welcome to OWW. Looks like you've been doing a ton of work to clean up and bring in new info on the Wikiomics pages. Looks great. One thing that might be useful to discuss is citation policy on OpenWetWare (and by extension on Wikiomics pages). OpenWetWare doesn't have a clear citation policy (beyond what is required by the [[OpenWetWare:Copyrights|Creative Common Attribution-Sharealike and GFDL licenses]] and the [[Special:Cite]] link on every regular article page under toolbox. It seems like the folks at Wikiomics gave more thought to this issue. Would you be interested in calling in to the next [[OpenWetWare:Steering committee|OWW steering committee]] meeting to talk about this more? (If you've already talked about this off-wiki with other folks, then never mind.) |
| | |
| * http://www.biomedcentral.com/1471-2105/7/499 (sequence alignment refinement paper)
| |
| | |
| * http://nar.oxfordjournals.org/cgi/content/full/33/22/7120 Automatic assessment of alignment quality
| |
| | |
| * ftp://ftp-igbmc.u-strasbg.fr/pub/RASCAL RASCAL 1.1
| |
| | |
| | |
| *http://www.dbi.tju.edu/dbi/index.php?menu=42 PAINT promoter database
| |
| | |
| * http://www.pdg.cnb.uam.es/fabascal/ tutorials ++
| |
| | |
| == microarrays ==
| |
| | |
| * http://depts.washington.edu/l2l/ Database of up/down regulated genes
| |
| | |
| ===databases===
| |
| * http://base.thep.lu.se/ BASE
| |
| * http://www.longhornarraydatabase.org/ LAD
| |
| * http://genome.tugraz.at/mars/mars_description.shtml MARS (2006) [http://www.biomedcentral.com/1471-2105/6/101 (doc HTML)]
| |
| * http://www.sbeams.org/Microarray/ SBEAMS
| |
| | |
| overview [http://scholar.google.com/scholar?hl=en&lr=&q=cache:WtBQy-JhcMUJ:www.russellpublishing.com/pharmaceutical/epr1048.pdf+lad+base+microarray]
| |
| | |
| =Videos bioinformatics=
| |
| * http://calit2.net/events/algorithmicbio/archive.php San Diego ALGORITHMIC BIOLOGY 2006
| |
| | |
| =Positive selection=
| |
| How to detect a pssitive selection of certain AA in a set of homologues sequences?:
| |
| | |
| * [http://selecton.bioinfo.tau.ac.il/ Selection (WEB)] (requires >=5 ORFs + query ORF. Can handle PDB files
| |
| * [http://oxytricha.princeton.edu/SWAKK/ SWAKK (WEB)]
| |
| * [http://www.may.ie/academic/biology/staff/mfmolecevolandbioinf.shtml SWAPSC] (standalone Win and Linux) PHYLIP formated input
| |
| | |
| | |
| =Sequence assembly=
| |
| ===First generation===
| |
| * [http://www.phrap.org/phredphrapconsed.html#block_phrap phrap]
| |
| * [http://www.tigr.org/software/assembler/ TIGR assembler]
| |
| * [http://genome.cs.mtu.edu/cap/cap3.html CAP3] [http://bioweb.pasteur.fr/seqanal/interfaces/cap3.html WWW@Pasteur]
| |
| | |
| ===Genome assemblers used in current genomic projects===
| |
| * [http://www.broad.mit.edu/wga/ Arachne] @Broad Inst (largest number of citations)
| |
| * [http://www.sanger.ac.uk/Software/production/phusion/ Phusion] @Sanger
| |
| * [http://www.hgsc.bcm.tmc.edu/downloads/software/atlas/ Atlas] @Baylor
| |
| | |
| * JAZZ -> @JGI in house only
| |
| * RAMEN (not published yet, used for medaka and silkworm projects)
| |
| | |
| ===New Programs===
| |
| * [http://amos.sourceforge.net/#minimus Minimus] suitable for bacterial genomes
| |
| * [http://nbcr.sdsc.edu/euler/euler2/ EULER] P.Pevzner graph algorithm producing superior contigs
| |
| requires phrap and patched [ftp://ftp.cs.arizona.edu/realigner/ ReAligner]
| |
| * [http://chevreux.org/projects_mira.html MIRA] Version 2.9.8 enables true hybrid sequence assembly (454 data with Sanger reads).
| |
| | |
| =Mutation/SNP detection=
| |
| | |
| * [http://genome.wustl.edu/tools/software/polyscan.cgi PolyScan] [http://www.genome.org/cgi/content/full/17/5/659 ref] New program claimed to be superior to MutationSurveyor/PolyPhred/SNPdetector
| |
| | |
| * [http://www.softgenetics.com/mutationSurveyor.html MutationSurveyor] $$$ program. 30 days demo available. MS3 has a limit of MS3 400 traces in a single project. GUI. Used in several diagnostic labs.
| |
| | |
| * [http://www.molgen.ua.ac.be/bioinfo/novosnp/ novoSNP] [http://www.genome.org/cgi/content/full/15/3/436 ref] Windows/Linux 2.0.3. GUI & command line on Linux.
| |
| | |
| * [ftp://ftp1.nci.nih.gov/pub/SNPdetector/ SNPdetector (ftp)] [http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1274293 ref]
| |
| | |
| * [http://genome.wustl.edu/tools/software/polybayes.cgi POLYBAYES] Perl program. [http://www.nature.com/ng/journal/v23/n4/full/ng1299_452.html ref]
| |
| | |
| * [http://www.mucosa.de/insnp/ InSNP] windows only, ABI base calls? detects substitution and indel SNPs in sequencing traces
| |
| | |
| * [http://droog.mbt.washington.edu/poly_get.html PolyPhred] [ref http://nar.oxfordjournals.org/cgi/content/full/25/14/2745] 1997 program, integrated with phred and Consed.
| |
| | |
| =ESTs clustering=
| |
| Paper:
| |
| | |
| * [http://www.ch.embnet.org/CoursEMBnet/Pages02/slides/est_clustering.pdf EMBnet course] (PDF)
| |
| | |
| Programs:
| |
| * [http://www.complex.iastate.edu/download/Lucy2/index.html Lucy2] standalone (Win Linux and MacOS)
| |
| | |
| ==Sequence assembly with ESTs enhancements===
| |
| * [http://www.chevreux.org/projects_mira.html MIRA2] also detects SNPs
| |
| | |
| | |
| See also table with less frequently used algorithms: http://biolinfo.org/EST/assembly.htm | |
| | |
| ==Alternative splicing==
| |
| * [http://alterna.cbrc.jp/ ASTRA (Alternative Splicing and TRanscription Archives)]
| |
| * [http://genome.ewha.ac.kr/ECgene/ ECgene] Genome Annotation for Alternative Splicing. Large number of putative splice forms.
| |
| | |
| =Sequence comparisons=
| |
| ==Protein orthologues==
| |
| * [http://www.ebi.ac.uk/~guy/exonerate/exonerate.man.html Exonerate] tool from sanger
| |
| * [http://inparanoid.sbc.su.se/ Inparanoid]
| |
| | |
| ==Genomic DNA==
| |
| * [http://pipmaker.bx.psu.edu/cgi-bin/pipmaker?basic PipMaker]
| |
| * [http://pipmaker.bx.psu.edu/cgi-bin/multipipmaker MultiPipMaker] http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=168985
| |
| | |
| * [http://www.biomedcentral.com/1471-2105/6/9 GATA paper]
| |
| GATA: a graphic alignment tool for comparative sequence analysis
| |
| | |
| ==Orthologues retrival==
| |
| * [http://orthomcl.cbil.upenn.edu/cgi-bin/OrthoMclWeb.cgi?rm=index OrthoMCL]
| |
| | |
| =Gene ontology=
| |
| * Tutorials http://www.geneontology.org/GO.teaching.resources.shtml Very extensiive!
| |
| | |
| == tutorials 2 check ==
| |
| | |
| * http://biophilessurf.info/tutorials.html
| |
| | |
| ==Genome annotation==
| |
| * [http://cbcb.umd.edu/software/jigsaw/ Jigsaw] meta-program designed to use the output from gene finders, splice site prediction programs and sequence alignments to predict gene models.
| |
| | |
| | |
| ===de novo predictions (eucariote, genomic level)===
| |
| * [http://augustus.gobics.de/ Augustus]
| |
| | |
| citation: http://genomebiology.com/2006/7/s1/S11
| |
| | |
| * [http://www.genezilla.org/ GeneZilla]
| |
| | |
| * [http://www.broad.mit.edu/annotation/conrad/ Conrad] java standalone
| |
| """The Conrad gene caller is tool for predicting gene structures in DNA based on the DNA sequence and other available evidence. The gene caller uses semi-Markov Conditional Random Fields. The Conrad CRF engineis a general purpose CRF engine used by the gene caller to provide the structure and algorithms for gene calling."""
| |
| | |
| To check: http://www.wormbase.org/wiki/index.php/NGASP
| |
| To read: http://compbiol.plosjournals.org/perlserv/?request=get-document&doi=10.1371%2Fjournal.pcbi.0030054
| |
| | |
| == syngr3 ==
| |
| | |
| RALGDS 2kb upstream
| |
| | |
| <pre>
| |
| | |
| >chromosome:NCBI36:9:134962328:135016542:-1
| |
| TGGCCCCAGGAGGCTAGAGTTGGGGTATAGGGACCAGGTCACACAGGGTTCTGAATGCCA
| |
| GGCTAGGAGGCAGGGGTCACCGCAGGCCTGTCCCAGCAGGGGGATCAATATATATGGGGC
| |
| CCAAGCGCTGGACTCAGGGGATACCTGGCCAGCGAGGCCCCAACACAGGATGAGGCCTCT
| |
| GATGACCAGCTCGGGGATGAGTGACGGGGAAGAGCCATGAAGTGGGGGTCACCACGCACA
| |
| GCAGGGCCTGGCCACTTACAGCTGAGTGGCCTGCAGTGCTGGTGCCTTGGCTCTGGTATA
| |
| AAATTGAATGAAGCCGGGCACAGTGGCTCACGCCTGTAATTGCGGCACTTTGGGAGGCCA
| |
| AGGCAGGAGGATCTCTGGAGCCCAAGAGTTCCAAACCAGCCTGGGCAACATAGTGAGACT
| |
| TCATCTCTACATAGTTTTTTTAAAAATAAAAAAGGCCGGGCACAGTGGCTCACGCCTGTA
| |
| ATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATTACGAGGTCAGAAGTTCCAGACCAGC
| |
| CTGGCCAACATAGTGAAACCCCGCCTCTACTAAAAATACAAAAATTAGCCGGGTGTGATG
| |
| GCACATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACGGGAGAATCACTTGAACCTGG
| |
| GAGGTGGAGGTTGCAGTGAGCTGAGACTGTGCCATTGCACTCCAGTCTGGGTGACAGAGT
| |
| GAGACTCTGTCTCAAAAAAATAAAATAAATAAATAAATCAAAAGGGTTGGCCAGGCAAAG
| |
| TGGCTCACGCCTGTAATCCCAACACTTTGGGAGGCCGAGGAGGGCAGATCACCTGAGGTC
| |
| AGAAGTTCGAGACCAGCCTGGCCAATATGGTGAAACTCTGTCTCTACTAAAAACACAAAA
| |
| ATTAGTCGGGCGTGGTGGTGGCAGCGTGCACCTGTAATCCCAGCTACTTGGGAGGCTGAG
| |
| ACAGGAGAATCGCTTGAACCCAGGAGGCAGAGGTTGCAATAAGCCGTGATCTAGCCACTG
| |
| CATTCCAGCCTGGTCGACAAGAAGGAGACTGCGGCTGGTGCAGTGGCTCATGCCTGTAAT
| |
| CCCAGCACTTTGGGAGGCCAAGGTGGGAGGATCACCTGACGTCTGGAGTTTGAGACCAGC
| |
| CTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAAAATTAGCCGGGCGTGGTGG
| |
| CAGGTGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATTGCTTGAACCTGGG
| |
| ACGTGGAGGTTGCAGTGAGCCGAGATCGCGCCATTGCACTCCAGCCTGGGGGACAAGAGT
| |
| GAGACTTCGTCTCAAAAAACAAACAAACGAGACTCCATCTCAAAAACAAAAGTAAATAAA
| |
| AAATAAAAAGGGACGAAATCAGTTAGCCCTAATAACACTGACTACCCCCAACAGTCGCTC
| |
| AACCCCAGTGTGAGGCCTCCTTCCCCCAGGCTCCCTTGAGCCCCATCTTACACCAGCTGA
| |
| AGCTGCAGCTGGACCTTGTGGTCCCGGGTGCTGTCAGGGAAGACAAGGAGGGAGGTGGGG
| |
| AAGAGGAGGGGAAGGGGAGACCTGACTTTCTCCCTGCCCAGGCTGAGTTCGCTGTCACCT
| |
| CGGGTCCCCCAGCTCCCAGCCATCCGCCGAGCCGAGTCCAGCAGGTGGCATCGGGGTGCT
| |
| GGGCGCCAGGGTGAACGTGTATATTTGGTGACGCCGGCGCGCCGACTCAGCGGCCCCCGC
| |
| CTGGCTGGGGCGAGGTTGGCCCTAGGTCCTAGCGGGGTGGGGAGTACTGAGCAGGCGGCT
| |
| GGGGCGGACGGACACGTGAGATCGGCCGCACATGGCGCTGGGAGCGTGGCGCGTGCGCGC
| |
| GGCGAAGCGGAGTGACGTGCACGCGCTGTCTGCGGTCCCGCGCAGGCCCCGTGTGCGCGC
| |
| CCGGCCTTGGACAACAGGCCCGGCTGCCCCGCGGGGGGAACACCCGCGTCGGCCCGCGGG
| |
| AGGGAGGCCTGAGCGCGCCCCCGAGCGCGTCCCCGAGCTCACGCGGCGGGGCGCGCCCCT
| |
| CGCACCTGCGGGCGGGCTGGGGCGGGGCCGCGGCTGTCCCCGCCCACCCGGGCCCGAGCC
| |
| CGGGGAGCCGGGGCGGAACCGAGCGGCGAGGCCCGAGCGGCCGGAGCGCGGCGCGGCGCA
| |
| GACAATGGGAGCGGCGCTGGCGGCTGCCGGGGCGGCCCCGAGGGCCGCAGAGTCCTGGGC
| |
| CCGGCGGGGACCGGAGGCCGCGCCATGAGCCCCGCAGCCGGGCGCACCCCTGCGCCGCGC
| |
| GCGGGCCCAGGCGAGCGGCCTCTGCGAGCCCCGGGTCCCGCCCTGGGGCCGGCGATGTGC
| |
| CACCGAGGCTGAGGATGATGGTAGATTGCCAG
| |
| | |
| </pre>
| |
| | |
| ==Pathways==
| |
| [http://cbio.mskcc.org/software/cpath/ CPath]
| |
| | |
| == Blast tabulated output ==
| |
| | |
| Columns:
| |
| * Identity of query sequence
| |
| * Identity of subject sequence (matching sequence in database)
| |
| * Percent identity
| |
| * Alignment length
| |
| * Number of mismatches
| |
| * Number of gaps
| |
| * Start of query sequence
| |
| * End of query sequence
| |
| * Start of subject sequence
| |
| * End of subject sequence
| |
| * E-value
| |
| * Bit-score
| |
| | |
| =Phylogeny=
| |
| ==tree checks==
| |
| * [http://www.ism.ac.jp/~shimo/ CONSEL]
| |
| CONSEL: for assessing the confidence of phylogenetic tree selection
| |
| Hidetoshi Shimodaira and Masami Hasegawa
| |
| http://bioinformatics.oxfordjournals.org/cgi/content/abstract/17/12/1246
| |
| | |
| * for clusters: [http://www.is.titech.ac.jp/~shimo/prog/pvclust PVCLUST] R package | |
| http://bioinformatics.oxfordjournals.org/cgi/content/full/22/12/1540
| |
| | |
| ==tree builders==
| |
| * [http://www.lirmm.fr/~w3ifa/MAAS/BIONJ/BIONJ.html BioNJ] (NJ trees -> same speed better accuracy for large number of taxa)
| |
| | |
| ==alignments==
| |
| * [http://www.ebi.ac.uk/goldman-srv/pandit/ PANDIT] database of multiple sequence alignments and phylogenetic trees covering many common protein domains.
| |
| | |
| =genome variants DB =
| |
| | |
| * [http://projects.tcag.ca/variation/ TCAG] curated catalogue of structural variation in the human genome
| |
| | |
| | |
| =stuff to incorporate =
| |
| | |
| * http://en.wikipedia.org/wiki/User:Darked/ABRF_2005
| |
| | |
| =Protein vs mRNA level differences=
| |
| | |
| '''Protein vs mRNA level deifferences'''
| |
| | |
| ==Stability of mRNA==
| |
| * Decapping of mRNA
| |
| * Deandenylation
| |
| | |
| ==Regulation of translation==
| |
| * number of ribbosomes per mRNA transcript
| |
| * binding of specific RBP (RNA binding proteins) to mRNA
| |
| =Graph visualisation=
| |
| * [Cytoscape http://www.cytoscape.org/]
| |
| * [http://ondex.sourceforge.net/ ONDEX]
| |
| | |
| =EST 2 genome alignment=
| |
| * [http://www2.fml.tuebingen.mpg.de/raetsch/projects/palma PALMA]
| |
| [http://bioinformatics.oxfordjournals.org/cgi/content/full/23/15/1892#F4 ref]
| |
| | |
| == Portugal ==
| |
| | |
| * [http://gtpb.igc.gulbenkian.pt/bicourses/ courses to check]
| |
| | |
| == motifs again... ==
| |
| | |
| * [http://nar.oxfordjournals.org/cgi/content/abstract/33/suppl_2/W442 FOOTER paper] web: http://biodev.hgen.pitt.edu/footer_php/Footerv2_0.php
| |
| | |
| == chip-chip ==
| |
| | |
| * Ringo (R package): http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1906858
| |
| | |
| check:
| |
| mpeak [4], TiMAT http://bdtnp.lbl.gov/TiMAT, MAT [5], TileMap [6], ACME [7], HGMM [8], and ChIPOTle [9]
| |
| | |
| == Mass spec progs + sites ==
| |
| | |
| * http://proteome.gs.washington.edu/
| |
| * MyriMatch http://pubs.acs.org/cgi-bin/abstract.cgi/jprobs/2007/6/i02/abs/pr0604054.html
| |
| * MyriMatch http://www.mc.vanderbilt.edu/msrc/bioinformatics/
| |
| * http://mass-spec.lsu.edu/blog/ Mass Spec blog
| |
| | |
| ==metagenomics==
| |
| * Strainer http://www.biomedcentral.com/1471-2105/8/398
| |
| | |
| == Taverna ==
| |
| | |
| * collection of workflows http://myexperiment.org/
| |