|
|
(13 intermediate revisions by the same user not shown) |
Line 1: |
Line 1: |
| == Report of Second Homework == | | == Report of Second Homework == |
|
| |
|
| The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting for me because I am an engineer and I like to see the problems from engineering point of view. | | The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting. |
| The paper was written in a very classic engineering manner and it made understanding of our position in Bioengineering more clear for me.
| |
| | |
| Installing and preparing Python was very different than the other programs which I used before like Matlab, C++.
| |
| I enjoyed using it, specially the object oriented programing ability makes it really powerful.
| |
| Plot for Python is very similar to Matlab and we have same commands with a little bit difference.
| |
| Here you see a plot for three different growth rates for exponential function plotted with different colors.
| |
| | |
| [[Image:plot1.jpg]]
| |
| | |
| ==Code for Third Homework==
| |
| import random
| |
| import numpy as np
| |
| | |
| print
| |
| print
| |
| | |
| Code='cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttaggccggttcctcttacttggcagagggaggc
| |
| tgctattctccgcctgcatttctttttctggattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatccctccc
| |
| cttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgctaccatggcgtagacagggagggaaagaagtgtgcagaaggc
| |
| aagcccggaggcactttcaagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaatgaaattttgaaagagtgc
| |
| aatgatgggtcgtttgataatttgtcgggaaaaacaatctacctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtc
| |
| gtgaagcggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccggttcttcctggtaggaggcggaactcgaat
| |
| tcatttctcccgctgccccatctcttagctcgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtgccgtac
| |
| ttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcacacagcaagtgcacaggaagatgagttttggcccctaaccgct
| |
| ccgtgatgcctaccaagtcacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccgaccccacctttattttga
| |
| tctccataaccattttgcctgttggagaacttcatatagaatggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcact
| |
| ttgggaggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg'
| |
| RCCode=Code
| |
| TempCode=Code
| |
| | |
| print 'Code=',Code
| |
| print
| |
| print
| |
| | |
| | |
| pro1=range(1,339)
| |
| pro2=range(1,339)
| |
| pro3=range(1,339)
| |
| prom1=range(1,339)
| |
| prom2=range(1,339)
| |
| prom3=range(1,339)
| |
| | |
| #----------------------Problem one --------------------------------------------
| |
| | |
| | |
| GCcontent=0
| |
| for i in range(0,len(Code)-1):
| |
| | |
| if Code[i]=='c':
| |
| GCcontent=GCcontent+1
| |
| elif Code[i]=='g':
| |
| GCcontent=GCcontent+1
| |
| | |
| | |
| | |
| | |
| print 'GC Content=',GCcontent
| |
| print
| |
| print
| |
| print
| |
| print
| |
| #----------------------Problem two---------------------------------------------
| |
| | |
| for i in range(0,len(Code)-1):
| |
| | |
| if Code[len(Code)-1-i]=='c':
| |
| RCCode=RCCode[:i]+'g'+RCCode[i+1:]
| |
| if Code[len(Code)-1-i]=='g':
| |
| RCCode=RCCode[:i]+'c'+RCCode[i+1:]
| |
| if Code[len(Code)-1-i]=='t':
| |
| RCCode=RCCode[:i]+'a'+RCCode[i+1:]
| |
| if Code[len(Code)-1-i]=='a':
| |
| RCCode=RCCode[:i]+'t'+RCCode[i+1:]
| |
| | |
| print 'Recerse Complement=:', RCCode
| |
| print
| |
| print
| |
| #----------------------Problem Three---------------------------------------------
| |
| Here we put the table That I didn't put because it doesn't look good!!!
| |
| | |
| for i in range(0,338):
| |
| | |
| Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
| |
| Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3]
| |
| Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
| |
| | |
| pro1[i]=standard[Temp1]
| |
| pro2[i]=standard[Temp2]
| |
| pro3[i]=standard[Temp3]
| |
| | |
| Temp1=RCCode[3*i]+RCCode[3*i+1]+RCCode[3*i+2]
| |
| Temp2=RCCode[3*i+1]+RCCode[3*i+2]+RCCode[3*i+3]
| |
| Temp3=RCCode[3*i+2]+RCCode[3*i+3]+RCCode[3*i+4]
| |
| | |
| prom1[i]=standard[Temp1]
| |
| prom2[i]=standard[Temp2]
| |
| prom3[i]=standard[Temp3]
| |
| | |
| | |
| | |
| print 'Sequence of (+1) frame'
| |
| print pro1
| |
| | |
| print 'Sequence of (+2) frame'
| |
| print pro2
| |
| | |
| print 'Sequence of (+3) frame'
| |
| print pro3
| |
| | |
| print 'Sequence of (-1) frame'
| |
| print prom1
| |
| | |
| print 'Sequence of (-2) frame'
| |
| print prom2
| |
| | |
| print 'Sequence of (-3) frame'
| |
| print prom3
| |
| | |
| | |
| #-----------------------------Problem Four---------------------------
| |
| | |
| counter=0
| |
| for j in range(0,1000):
| |
| | |
| Code=TempCode
| |
| for i in range(0,10):
| |
| | |
| Te=random.random()
| |
| Te=np.fix(100*Te)
| |
| Te2=random.random()
| |
| Te2=int(np.fix(10*Te2))%3
| |
|
| |
|
| |
| | |
|
| |
|
| |
| if (Code[100*i+int(Te)]=='c') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='c') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='c') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
| |
| | |
| | |
| | |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='t') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='t') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='t') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
| |
| | |
| | |
| | |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='g') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='g') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='g') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
| |
| | |
| | |
| | |
| | |
| elif (Code[100*i+int(Te)]=='a') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='a') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='a') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| | |
| | |
| | |
| pro21=range(1,339)
| |
| pro22=range(1,339)
| |
| pro23=range(1,339)
| |
| | |
| | |
| | |
| | |
| for i in range(0,338):
| |
| | |
| Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
| |
| Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3]
| |
| Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
| |
| | |
| pro21[i]=standard[Temp1]
| |
| pro22[i]=standard[Temp2]
| |
| pro23[i]=standard[Temp3]
| |
| | |
|
| |
| for i in range(0,len(pro21)-1):
| |
| | |
| if pro21[i]=='*' and pro1[i]!='*':
| |
| counter=counter+1
| |
|
| |
| | |
| print 'Percent of Premature Termination=',counter,'/1000'
| |
| print
| |
| print
| |
| | |
| print 'Before Mutation:', pro1
| |
| print
| |
| print
| |
| | |
| print 'After Mutation:', pro21
| |
| | |
| input()
| |
| | |
| == Project ==
| |
| I want to try and understand the information structure in different evolutionary dynamics.
| |
| | |
| By Information structure I mean looking at entire path of evolution and trying to understand a unique structure for that.
| |
| | |
| We already have a big lab of evolutionary dynamics in the nature and human society. For example considering a replication and selection structure for language evolution will give us a good sense of how replication and mutation iteratively make selection to vary. We can call teaching or spreading a word among people replication and selection will happen if a word is useful and easy to use. This path will lead us to build structures which we call it grammar and then grammar will act as a new selection for new objects which we want to generate. Mutation is the change in the words or making new words.
| |
| | |
| | |
| Generalizing evolutionary idea in this way helps us to develop a measurement to understand this big sample we have so far and think about future of that. There will be big parallels among different paths like evolution of language , evolution of science and etc. Also we will see some differences like the rate of evolution which will give us some intrinsic property of this path for different cases.
| |
| | |
| | |
| I will write more...
| |