User talk:Hossein Azari Soufiani: Difference between revisions
Line 238: | Line 238: | ||
==December report for project == | ==December report for project == |
Revision as of 16:54, 19 March 2010
Report of Second Homework
The paper "Foundations for the Engineering Biology" was really interesting for me because I am an engineer and I like to see the problems from engineering point of view. The paper was written in a very classic engineering manner and it made understanding of our position in Bioengineering more clear for me.
Installing and preparing Python was very different than the other programs which I used before like Matlab, C++. I enjoyed using it, specially the object oriented programing ability makes it really powerful. Plot for Python is very similar to Matlab and we have same commands with a little bit difference. Here you see a plot for three different growth rates for exponential function plotted with different colors.
Code for Third Homework
import random import numpy as np
print print
Code='cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttaggccggttcctcttacttggcagagggaggc tgctattctccgcctgcatttctttttctggattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatccctccc cttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgctaccatggcgtagacagggagggaaagaagtgtgcagaaggc aagcccggaggcactttcaagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaatgaaattttgaaagagtgc aatgatgggtcgtttgataatttgtcgggaaaaacaatctacctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtc gtgaagcggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccggttcttcctggtaggaggcggaactcgaat tcatttctcccgctgccccatctcttagctcgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtgccgtac ttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcacacagcaagtgcacaggaagatgagttttggcccctaaccgct ccgtgatgcctaccaagtcacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccgaccccacctttattttga tctccataaccattttgcctgttggagaacttcatatagaatggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcact ttgggaggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg' RCCode=Code TempCode=Code
print 'Code=',Code print print
pro1=range(1,339)
pro2=range(1,339)
pro3=range(1,339)
prom1=range(1,339)
prom2=range(1,339)
prom3=range(1,339)
- ----------------------Problem one --------------------------------------------
GCcontent=0
for i in range(0,len(Code)-1):
if Code[i]=='c': GCcontent=GCcontent+1 elif Code[i]=='g': GCcontent=GCcontent+1
print 'GC Content=',GCcontent
print
print
print
print
- ----------------------Problem two---------------------------------------------
for i in range(0,len(Code)-1):
if Code[len(Code)-1-i]=='c': RCCode=RCCode[:i]+'g'+RCCode[i+1:] if Code[len(Code)-1-i]=='g': RCCode=RCCode[:i]+'c'+RCCode[i+1:] if Code[len(Code)-1-i]=='t': RCCode=RCCode[:i]+'a'+RCCode[i+1:] if Code[len(Code)-1-i]=='a': RCCode=RCCode[:i]+'t'+RCCode[i+1:]
print 'Recerse Complement=:', RCCode print print
- ----------------------Problem Three---------------------------------------------
Here we put the table That I didn't put because it doesn't look good!!!
for i in range(0,338):
Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2] Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
pro1[i]=standard[Temp1] pro2[i]=standard[Temp2] pro3[i]=standard[Temp3]
Temp1=RCCode[3*i]+RCCode[3*i+1]+RCCode[3*i+2] Temp2=RCCode[3*i+1]+RCCode[3*i+2]+RCCode[3*i+3] Temp3=RCCode[3*i+2]+RCCode[3*i+3]+RCCode[3*i+4]
prom1[i]=standard[Temp1] prom2[i]=standard[Temp2] prom3[i]=standard[Temp3]
print 'Sequence of (+1) frame' print pro1
print 'Sequence of (+2) frame' print pro2
print 'Sequence of (+3) frame' print pro3
print 'Sequence of (-1) frame' print prom1
print 'Sequence of (-2) frame' print prom2
print 'Sequence of (-3) frame' print prom3
- -----------------------------Problem Four---------------------------
counter=0 for j in range(0,1000):
Code=TempCode for i in range(0,10):
Te=random.random() Te=np.fix(100*Te) Te2=random.random() Te2=int(np.fix(10*Te2))%3
if (Code[100*i+int(Te)]=='c') and (Te2==1): Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='c') and (Te2==2): Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='c') and (Te2==0): Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='t') and (Te2==1): Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='t') and (Te2==2): Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='t') and (Te2==0): Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='g') and (Te2==1): Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='g') and (Te2==2): Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='g') and (Te2==0): Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='a') and (Te2==1): Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='a') and (Te2==2): Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='a') and (Te2==0): Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
pro21=range(1,339) pro22=range(1,339) pro23=range(1,339)
for i in range(0,338):
Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2] Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
pro21[i]=standard[Temp1] pro22[i]=standard[Temp2] pro23[i]=standard[Temp3]
for i in range(0,len(pro21)-1):
if pro21[i]=='*' and pro1[i]!='*': counter=counter+1
print 'Percent of Premature Termination=',counter,'/1000' print print
print 'Before Mutation:', pro1 print print
print 'After Mutation:', pro21
input()
December report for project
During this project we started from looking at the dogma of biological systems and we tried to discus on the evolutionary development.
After dividing into groups we as mathematical modeling started to look at a model which encompass the evolutionary notion of development in it. Basically it uses Control theory ideas to design a system which will use a feedback system which optimally will use the experiment results as much as possible.
After proposing our system and having discussion in the class we went forward to an numerical example. After discussions with biology group and infrastructure we got two examples as eye-color and height.
So far we are working on the logistic modeling and we will use this method on the results that infrastructure part will give us from online resources.
Details of our group discussion is on the wiki.
This was a very good initiative for bio processing for me and the way we started to understand the details of this evolving path and start to think together to overcome the problems.
Thanks George a lot for shedding light in this way for us and thanks Harris and Sasha for their helps.
With all the best, Hossein