User talk:Hossein Azari Soufiani

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Report of Second Homework)
(Code for Third Homework)
Line 2: Line 2:
The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting.
The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting.
-
 
-
==Code for Third Homework==
 
-
import random
 
-
import numpy as np
 
-
 
-
print
 
-
print
 
-
 
-
Code='cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttaggccggttcctcttacttggcagagggaggc
 
-
tgctattctccgcctgcatttctttttctggattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatccctccc
 
-
cttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgctaccatggcgtagacagggagggaaagaagtgtgcagaaggc
 
-
aagcccggaggcactttcaagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaatgaaattttgaaagagtgc
 
-
aatgatgggtcgtttgataatttgtcgggaaaaacaatctacctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtc
 
-
gtgaagcggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccggttcttcctggtaggaggcggaactcgaat
 
-
tcatttctcccgctgccccatctcttagctcgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtgccgtac
 
-
ttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcacacagcaagtgcacaggaagatgagttttggcccctaaccgct
 
-
ccgtgatgcctaccaagtcacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccgaccccacctttattttga
 
-
tctccataaccattttgcctgttggagaacttcatatagaatggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcact
 
-
ttgggaggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg'
 
-
RCCode=Code
 
-
TempCode=Code
 
-
 
-
print 'Code=',Code
 
-
print
 
-
print
 
-
 
-
 
-
pro1=range(1,339)
 
-
pro2=range(1,339)
 
-
pro3=range(1,339)
 
-
prom1=range(1,339)
 
-
prom2=range(1,339)
 
-
prom3=range(1,339)
 
-
 
-
#----------------------Problem one --------------------------------------------
 
-
 
-
 
-
GCcontent=0
 
-
for i in range(0,len(Code)-1):
 
-
 
-
if Code[i]=='c':
 
-
  GCcontent=GCcontent+1
 
-
elif Code[i]=='g':
 
-
  GCcontent=GCcontent+1
 
-
 
-
 
-
 
-
 
-
print 'GC Content=',GCcontent
 
-
print
 
-
print
 
-
print
 
-
print
 
-
#----------------------Problem two---------------------------------------------
 
-
 
-
for i in range(0,len(Code)-1):
 
-
 
-
if  Code[len(Code)-1-i]=='c':
 
-
  RCCode=RCCode[:i]+'g'+RCCode[i+1:]
 
-
if  Code[len(Code)-1-i]=='g':
 
-
  RCCode=RCCode[:i]+'c'+RCCode[i+1:]
 
-
if  Code[len(Code)-1-i]=='t':
 
-
  RCCode=RCCode[:i]+'a'+RCCode[i+1:]
 
-
if  Code[len(Code)-1-i]=='a':
 
-
  RCCode=RCCode[:i]+'t'+RCCode[i+1:]
 
-
 
-
print 'Recerse Complement=:', RCCode
 
-
print
 
-
print
 
-
#----------------------Problem Three---------------------------------------------
 
-
Here we put the table That I didn't put because it doesn't look good!!!
 
-
 
-
for i in range(0,338):
 
-
 
-
Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
 
-
Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] 
 
-
Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
 
-
 
-
pro1[i]=standard[Temp1]
 
-
pro2[i]=standard[Temp2]
 
-
pro3[i]=standard[Temp3]
 
-
 
-
Temp1=RCCode[3*i]+RCCode[3*i+1]+RCCode[3*i+2]
 
-
Temp2=RCCode[3*i+1]+RCCode[3*i+2]+RCCode[3*i+3] 
 
-
Temp3=RCCode[3*i+2]+RCCode[3*i+3]+RCCode[3*i+4]
 
-
 
-
prom1[i]=standard[Temp1]
 
-
prom2[i]=standard[Temp2]
 
-
prom3[i]=standard[Temp3]
 
-
 
-
 
-
 
-
print 'Sequence of (+1) frame'
 
-
print pro1
 
-
 
-
print 'Sequence of (+2) frame'
 
-
print pro2
 
-
 
-
print 'Sequence of (+3) frame'
 
-
print pro3
 
-
 
-
print 'Sequence of (-1) frame'
 
-
print prom1
 
-
 
-
print 'Sequence of (-2) frame'
 
-
print prom2
 
-
 
-
print 'Sequence of (-3) frame'
 
-
print prom3
 
-
 
-
 
-
#-----------------------------Problem Four---------------------------
 
-
 
-
counter=0
 
-
for j in range(0,1000):
 
-
 
-
        Code=TempCode
 
-
        for i in range(0,10):
 
-
 
-
                Te=random.random()
 
-
                Te=np.fix(100*Te)
 
-
                Te2=random.random()
 
-
                Te2=int(np.fix(10*Te2))%3
 
-
               
 
-
               
 
-
 
-
               
 
-
               
 
-
                if  (Code[100*i+int(Te)]=='c') and (Te2==1):
 
-
                      Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
 
-
                     
 
-
               
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='c') and (Te2==2):
 
-
                      Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
 
-
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='c') and (Te2==0):
 
-
                      Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
 
-
 
-
 
-
 
-
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='t') and (Te2==1):
 
-
                      Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
 
-
               
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='t') and (Te2==2):
 
-
                      Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
 
-
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='t') and (Te2==0):
 
-
                      Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
 
-
 
-
 
-
 
-
               
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='g') and (Te2==1):
 
-
                      Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
 
-
               
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='g') and (Te2==2):
 
-
                      Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
 
-
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='g') and (Te2==0):
 
-
                      Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
 
-
 
-
 
-
 
-
 
-
                elif  (Code[100*i+int(Te)]=='a') and (Te2==1):
 
-
                      Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
 
-
               
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='a') and (Te2==2):
 
-
                      Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
 
-
 
-
               
 
-
                elif  (Code[100*i+int(Te)]=='a') and (Te2==0):
 
-
                      Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
 
-
 
-
             
 
-
 
-
 
-
 
-
        pro21=range(1,339)
 
-
        pro22=range(1,339)
 
-
        pro23=range(1,339)
 
-
 
-
 
-
 
-
 
-
        for i in range(0,338):
 
-
 
-
                Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
 
-
                Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] 
 
-
                Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
 
-
 
-
                pro21[i]=standard[Temp1]
 
-
                pro22[i]=standard[Temp2]
 
-
                pro23[i]=standard[Temp3]
 
-
 
-
               
 
-
        for i in range(0,len(pro21)-1):
 
-
 
-
                if  pro21[i]=='*' and pro1[i]!='*':
 
-
                        counter=counter+1
 
-
   
 
-
 
-
print 'Percent of Premature Termination=',counter,'/1000'
 
-
print
 
-
print
 
-
 
-
print 'Before Mutation:', pro1
 
-
print
 
-
print
 
-
 
-
print 'After Mutation:',  pro21
 
-
 
-
input()
 
-
 
-
 
-
 
-
 

Revision as of 08:49, 27 May 2010

Report of Second Homework

The paper "Foundations for the Engineering Biology" was really interesting.


December report for project

During this project we started from looking at the dogma of biological systems and we tried to discus on the evolutionary development.

After dividing into groups we as mathematical modeling started to look at a model which encompass the evolutionary notion of development in it. Basically it uses Control theory ideas to design a system which will use a feedback system which optimally will use the experiment results as much as possible.

After proposing our system and having discussion in the class we went forward to an numerical example. After discussions with biology group and infrastructure we got two examples as eye-color and height.

So far we are working on the logistic modeling and we will use this method on the results that infrastructure part will give us from online resources.

Details of our group discussion is on the wiki.

This was a very good initiative for bio processing for me and the way we started to understand the details of this evolving path and start to think together to overcome the problems.

Thanks George a lot for shedding light in this way for us and thanks Harris and Sasha for their helps.

With all the best, Hossein

Personal tools