User talk:Hossein Azari Soufiani
Hello, Hossein Azari Soufiani! This is a welcome message from OpenWetWare. By the way, we've announced you on the home page! You can leave messages to any OWW member by editing their User_talk pages like this one. And don't forget to personalize your User Page so that we can get to know you better! We've included some tips below to get you started.
Report of Second Homework
The paper "Foundations for the Engineering Biology" was really interesting for me because I am an engineer and I like to see the problems from engineering point of view. The paper was written in a very classic engineering manner and it made understanding of our position in Bioengineering more clear for me.
Installing and preparing Python was very different than the other programs which I used before like Matlab, C++. I enjoyed using it, specially the object oriented programing ability makes it really powerful. Plot for Python is very similar to Matlab and we have same commands with a little bit difference. Here you see a plot for three different growth rates for exponential function plotted with different colors.
Code for Third Homework
import random import numpy as np
print print
Code='cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttaggccggttcctcttacttggcagagggaggc tgctattctccgcctgcatttctttttctggattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatccctccc cttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgctaccatggcgtagacagggagggaaagaagtgtgcagaaggc aagcccggaggcactttcaagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaatgaaattttgaaagagtgc aatgatgggtcgtttgataatttgtcgggaaaaacaatctacctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtc gtgaagcggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccggttcttcctggtaggaggcggaactcgaat tcatttctcccgctgccccatctcttagctcgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtgccgtac ttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcacacagcaagtgcacaggaagatgagttttggcccctaaccgct ccgtgatgcctaccaagtcacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccgaccccacctttattttga tctccataaccattttgcctgttggagaacttcatatagaatggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcact ttgggaggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg' RCCode=Code TempCode=Code
print 'Code=',Code print print
pro1=range(1,339)
pro2=range(1,339)
pro3=range(1,339)
prom1=range(1,339)
prom2=range(1,339)
prom3=range(1,339)
- ----------------------Problem one --------------------------------------------
GCcontent=0
for i in range(0,len(Code)-1):
if Code[i]=='c': GCcontent=GCcontent+1 elif Code[i]=='g': GCcontent=GCcontent+1
print 'GC Content=',GCcontent
print
print
print
print
- ----------------------Problem two---------------------------------------------
for i in range(0,len(Code)-1):
if Code[len(Code)-1-i]=='c': RCCode=RCCode[:i]+'g'+RCCode[i+1:] if Code[len(Code)-1-i]=='g': RCCode=RCCode[:i]+'c'+RCCode[i+1:] if Code[len(Code)-1-i]=='t': RCCode=RCCode[:i]+'a'+RCCode[i+1:] if Code[len(Code)-1-i]=='a': RCCode=RCCode[:i]+'t'+RCCode[i+1:]
print 'Recerse Complement=:', RCCode print print
- ----------------------Problem Three---------------------------------------------
Here we put the table That I didn't put because it doesn't look good!!!
for i in range(0,338):
Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2] Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
pro1[i]=standard[Temp1] pro2[i]=standard[Temp2] pro3[i]=standard[Temp3]
Temp1=RCCode[3*i]+RCCode[3*i+1]+RCCode[3*i+2] Temp2=RCCode[3*i+1]+RCCode[3*i+2]+RCCode[3*i+3] Temp3=RCCode[3*i+2]+RCCode[3*i+3]+RCCode[3*i+4]
prom1[i]=standard[Temp1] prom2[i]=standard[Temp2] prom3[i]=standard[Temp3]
print 'Sequence of (+1) frame' print pro1
print 'Sequence of (+2) frame' print pro2
print 'Sequence of (+3) frame' print pro3
print 'Sequence of (-1) frame' print prom1
print 'Sequence of (-2) frame' print prom2
print 'Sequence of (-3) frame' print prom3
- -----------------------------Problem Four---------------------------
counter=0 for j in range(0,1000):
Code=TempCode for i in range(0,10):
Te=random.random() Te=np.fix(100*Te) Te2=random.random() Te2=int(np.fix(10*Te2))%3
if (Code[100*i+int(Te)]=='c') and (Te2==1): Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='c') and (Te2==2): Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='c') and (Te2==0): Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='t') and (Te2==1): Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='t') and (Te2==2): Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='t') and (Te2==0): Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='g') and (Te2==1): Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='g') and (Te2==2): Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='g') and (Te2==0): Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='a') and (Te2==1): Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='a') and (Te2==2): Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='a') and (Te2==0): Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
pro21=range(1,339) pro22=range(1,339) pro23=range(1,339)
for i in range(0,338):
Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2] Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
pro21[i]=standard[Temp1] pro22[i]=standard[Temp2] pro23[i]=standard[Temp3]
for i in range(0,len(pro21)-1):
if pro21[i]=='*' and pro1[i]!='*': counter=counter+1
print 'Percent of Premature Termination=',counter,'/1000' print print
print 'Before Mutation:', pro1 print print
print 'After Mutation:', pro21
input()
Personal/Lab Info
We have gone ahead and filled in some information you provided us in your membership application on your User Page. Please take a moment to embellish this and tell the community a little more about you. Put links to your lab pages, your projects and your interests. If you run out of ideas, take a look at some of the other User pages. For example, check out User:Julius_B._Lucks, User:Jason_R._Kelly and User:Reshma_P._Shetty.
You'll also notice that we have put an 'image' placeholder at the top of your User Page. We encourage you to upload an image of yourself to give OWW a more personal feel. To upload an image, click on the Upload file link on the left-hand side (toolbar). Choose a file from your computer, and remember the file name. After you have uploaded the image, you should see it loaded on its own page. Go back to your User Page, click on edit, and replace 'OWWEmblem.png' with the name of your file that you have uploaded in the second line of this page.