User talk:Nkuldell/SAGA swap pt 2

From OpenWetWare

Revision as of 11:20, 19 July 2006 by Nkuldell (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Contents

SGF73 emailed info

1.

From: Mark Hickman Subject: Re: memory lapses... Date: Sun, 11 Jun 2006 21:32:42 -0400

SGF73 is required for the induction of the PAU genes under hypoxic conditions. As far as I know, this is the first transcriptional defect seen for sgf73 mutants. Otherwise, nothing is known about its function. Dom worked on human Sgf73 for his PhD thesis; he found it was subject to glutamine expansion. One of my plans for the future was to check whether sgf73 deletion has a phenotype, especially under hypoxic conditions (since there might be a consequence to the PAU genes not being induced). Another idea was to do a synthetic lethal screen with sgf73 under aerobic and hypoxic conditions.

We have the cerevisiae sgf73 deletion strain (I have worked with FY2475). Not sure if there is a cDNA, but Fred or Lisa might know.

Let me know if you have any other questions. You could also ask Dom about pombe sgf73+. He might be knocking that out and/or have a cDNA.

Thanks for the anniversary wishes! It's July 31. I guess we are still newlyweds until the first year?

Good luck with your son's surgery. I have a memory lapse too: your son's name.

See you soon Mark


2.

From: Mark Hickman Subject: Re: memory lapses... Date: Fri, 23 Jun 2006 11:25:35 -0400

Natalie,

No problem! Just got back from Venice. How did it go with Spencer?

It's MAT alpha ura3-52 lys2-173R2 leu2D1 arg4-12 sgf73D0::kanMX his4-917d. I am assuming it's a clean ORF deletion but not sure. It should be in Jenny's notebook, or maybe Lisa knows? Won't you need to put in URA3, so you can do the swap with 5FOA?

Do you know about the Winston Lab yeast strains on the web? http://genepath.med.harvard.edu/strainfinder/yeast.php

Lisa is still in the lab. Not much longer though....

Mark

3.

From: Mark Hickman Subject: Re: memory lapses... Date: Fri, 23 Jun 2006 11:49:41 -0400

Natalie, I just happened to come across a file (totally randomly!) with Jenny's knockout primers: Sgf73 JW109 left primer 5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAA ctgtgcggtatttcacaccg JW110 right primer 5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAA agattgtactgagagtgcac

Sequence details

URA3 from pRS416 according to NEB site

URA3 from SGD is 804 bp vs this gene that weighs in at 1213 bases. SGD BLAST gives perfect match to SGD URA3 sequence from 1-804

      1 A TGTCGAAAGC TACATATAAG GAACGTGCTG CTACTCATCC  
    451  TAGTCCTGTT GCTGCCAAGC TATTTAATAT CATGCACGAA AAGCAAACAA 
    501  ACTTGTGTGC TTCATTGGAT GTTCGTACCA CCAAGGAATT ACTGGAGTTA 
    551  GTTGAAGCAT TAGGTCCCAA AATTTGTTTA CTAAAAACAC ATGTGGATAT 
    601  CTTGACTGAT TTTTCCATGG AGGGCACAGT TAAGCCGCTA AAGGCATTAT 
    651  CCGCCAAGTA CAATTTTTTA CTCTTCGAAG ACAGAAAATT TGCTGACATT 
    701  GGTAATACAG TCAAATTGCA GTACTCTGCG GGTGTATACA GAATAGCAGA 
    751  ATGGGCAGAC ATTACGAATG CACACGGTGT GGTGGGCCCA GGTATTGTTA 
    801  GCGGTTTGAA GCAGGCGGCA GAAGAAGTAA CAAAGGAACC TAGAGGCCTT 
    851  TTGATGTTAG CAGAATTGTC ATGCAAGGGC TCCCTATCTA CTGGAGAATA 
    901  TACTAAGGGT ACTGTTGACA TTGCGAAGAG CGACAAAGAT TTTGTTATCG 
    951  GCTTTATTGC TCAAAGAGAC ATGGGTGGAA GAGATGAAGG TTACGATTGG 
   1001  TTGATTATGA CACCCGGTGT GGGTTTAGAT GACAAGGGAG ACGCATTGGG 
   1051  TCAACAGTAT AGAACCGTGG ATGATGTGGT CTCTACAGGA TCTGACATTA 
   1101  TTATTGTTGG AAGAGGACTA TTTGCAAAGG GAAGGGATGC TAAGGTAGAG 
   1151  GGTGAACGTT ACAGAAAAGC AGGCTGGGAA GCATATTTGA GAAGATGCGG 
   1201  CCAGCAAAAC TAA
Personal tools