User talk:Nkuldell/mtDNA pt2

From OpenWetWare
Revision as of 08:51, 14 July 2006 by Nkuldell (talk | contribs)
Jump to navigationJump to search

DNA Reagents

HEM1 reporter

  • HEM1 [1]
    • 5-aminolevulinate synthase ("ALA synthase"), catalyzes the first step in the heme biosynthetic pathway [2]; an N-terminal signal sequence is required for localization to the mitochondrial matrix; expression is regulated by Hap2p-Hap3p
    • nuclear gene is 1.647 kb [3], protein is 549 aa [4]
    • SGD reports systematic deletion is inviable but also reports null is viable, heme and methionine auxotroph
    • Mark has nuclear K/O with KanMX

Genotype of yMH339: MATa ura3D0 his3D200 leu2D0 lys2-128d HAP1 hem1D::KanMX
Geneology note: yMH36 hem1D::KanMX #1 03/14/06

    • nuclear K/O requires addition of 8,5-amino-levulinate to grow. Same compound is also called d-ALA and can be ordered from Sigma (A7793, 500 mg bottle to store dessicated at -20°). Stock is 20 mg/ml in dH20 and can store aliquots at -20° to freeze/thaw. Working concentration is 200 ug/ml to fully overcome HEM1 deletion by providing product of HEM1 catalyzed reaction. must spread 300 ul on plates of any kind for hem1 deletion strain to grow
    • Mark believes there is a UV or spec method for measuring heme levels
    • alternatively could epitope tag at C-terminus (N-terminus is used for mt import and probably shouldn't mess with this section for fusion). Possible tags are HA, c-myc or better still (if possible) might be alpha-complementing portion of b-gal. . Defined as first 81 aa in [5]. Could then select for mitochondrial expression of HEM1 in nuclear mutant by selection on -heme or -met plates and measure expression levels with Western if alpha-specific antibody is available (note: HEM1 antiserum described in very old paper [6], and assay on X-gal plates or liquid assay in strain expressing mito-targetted M15-portion. If fusion was directed to COX2 (instead of other regions of mito genome that will eventually want to clean up) then can select for integrants as respiration defective, and don't need to worry about
    • heme req'd in
  1. ergosterol biosynthesis pathway[7]
  2. fatty acid biosynthesis pathway [8]] , and
  3. methionine biosynthesis pathway [9]
    though no step directly requiring heme seen from cursory look at biochemical pathways.
  • Primers already made:
    • FO2827 (aka MH107) to replace ORF of HEM1 with pRS marker
      5'-CCTCAATAATCATAACAGTACTTAGGTTTTTTTTTCAGTAGATTGTACTGAGAGTGCAC
    • FO2828 (aka MH108) to replace ORF of HEM1 with pRS marker
      5'-CTTGTACCTCTATCTCAGCCCATGCATATATTGGTTGTTCTGTGCGGTATTTCACACCG
    • FO2829 (aka MH109) to prime 170 bp upstm of HEM1 start codon
      5'-TCTTCCTTTACACGCCTTCC
    • FO2830 (aka MH110) to prime 197 bp dwnstm from HEM1 stop codon
      5'-CTACAGTTTAACCATTGCAG
  • HEM1 deletion lead to respiration-defective strain but can overcome by addition of d-ala. True respiration defect (e.g. cox mutn) will not grow on non-fermentable carbon source even with d-ala.

HA epitope tag

YPYDVPDYA (influenza hemagglutinin-HA-epitope)
Abcam antibody conjugated to HRP [10]

alpha-complementation

  • Bacterial ref: Ullmann, Jacob, Monod (1967) JMB [11]
  • Yeast ref: Abbas-Terki and Picard (1999) Eur J Biochem [12]
  • Mammalian ref: Moosmann and Rusconi (1996) NAR [13]
    and more recently changing affinity of alpha and omega fragments to look at protein translocation Wehrman, Casipit, Gewertz and Blau (2005) Nature Methods [14]

BBa_Y00012

mitochondrial LYS12

  • S. cerevisiae gene LYS12 [15] is required for the fourth step of lysine biosynthesis. It is normally encoded by the nuclear genome and the protein is imported to the mitochondria where it oxidatively decarboxylates homo-isocitrate to alpha-ketoadipate. Strains deleted for LYS12 are viable but show decreased growth in the absence of lysine. Part Y00012 is the S. cerevisiae LYS12 gene that has been recoded for expression in the mitochondria, which uses a different genetic code and separate transcription/translation machinery for expression mitochondrial genes. The part is start to stop flanked by biobrick ends so has no promoter for expression or sequences for recombination into the mitochondria.

Note 07.07.06 : lys12 from deletion set grows ~wt on SC-lys plates (unlike lys2 from deletion set). Check if the strain is correct by ordering primers outside of LYS12 (Winston has KanMX specific primers for inside = FO1310 (Tm 65) and FO1311 (Tm 57)) as well as LYS2 primer pair for positive control (also from Winston oligo ollection) LYS2up is -132 to -115 upstream of ATG +1, seq =5'-CGC-TGG-GAG-AAG-TTC-AAG-3' and LYS2down is 5'-GAA-GCT-GCC-ATT-AGC-AGAC-3'

Email'd info

1

From: "Barry Canton" Subject: Re: T7 RNAP in eukaryotes X-Google-Sender-Auth: a8abf99ae0e404b7

Still here Natalie:) You can definitely get T7 transcription working in some eukaryotes, I'm not sure about yeast. I've included the two refs. I have below but there may be more. Also, thanks for the note about the clones, they will be very useful if the team decide to go that way. Barry

@article{He1995oz, 

   Abstract = {We have developed expression vectors that direct the synthesis of proteins from a common set of signals in both prokaryotic and eukaryotic cells. To allow transcription from a common promoter the vectors rely upon a phage RNA polymerase (RNAP). To direct initiation of translation to the same start codon the vectors utilize an internal ribosome entry site (IRES) from encephalomyocarditis virus (EMCV) that has been modified to include a prokaryotic ribosome-binding site (RBS) at an appropriate distance upstream from the desired start codon. These vectors provide levels of expression in eukaryotic cells that exceed those of a conventional RNAP-II-based system by 7-fold, and expression in bacterial cells at levels comparable to other phage RNAP-based systems. Inclusion of a lac repressor and a phage promoter/lac operator fusion element allows tight regulation. Cotransfection of eukaryotic cells with the expression vector and a vector that encodes the phage RNAP provides high-level transient expression without the need to construct specialized stable cell lines.},
   Affiliation = {Morse Institute for Molecular Genetics, Department of Microbiology and Immunology, SUNY Health Science Center at Brooklyn 11203-2098, USA.},
   Aid = {037811199500475L {$[$}pii{$]$}},
   Au = {Durbin RK},
   Author = {He, B and McAllister, W T and Durbin, R K},
   Da = {19951212},
   Date-Modified = {2006-01-13 16:29:43 -0500},
   Dcom = {19951212},
   Edat = {1995/10/16},
   Gr = {GM38147/GM/NIGMS},
   Jid = {7706761},
   Journal = {Gene},
   Keywords = {Virtual Machines and Dedicated Synthesis and Transcription},
   Language = {eng},
   Local-Url = {<file://localhost/Users/Barry/Desktop/Papers/He/He1995yi.pdf> file://localhost/Users/Barry/Desktop/Papers/He/He1995yi.pdf},
   Lr = {20041117},
   Mhda = {1995/10/16 00:01},
   Number = {1},
   Own = {NLM},
   Pages = {75-9},
   Pl = {NETHERLANDS},
   Pmid = {7590325},
   Pst = {ppublish},
   Pt = {Journal Article},
   Pubm = {Print},
   Rn = {EC <http://3.1.3.1>3.1.3.1 (Alkaline Phosphatase)},
   Sb = {IM},
   Stat = {MEDLINE},
   Title = {Phage RNA polymerase vectors that allow efficient gene expression in both prokaryotic and eukaryotic cells.},
   Volume = {164},
   Year = {1995}}


@article{Fuerst1986po, 

   Abstract = {DNA coding for bacteriophage T7 RNA polymerase was ligated to a vaccinia virus transcriptional promoter and integrated within the vaccinia virus genome. The recombinant vaccinia virus retained infectivity and stably expressed T7 RNA polymerase in mammalian cells. Target genes were constructed by inserting DNA segments that code for beta-galactosidase or chloramphenicol acetyltransferase into a plasmid with bacteriophage T7 promoter and terminator regions. When cells were infected with the recombinant vaccinia virus and transfected with plasmids containing the target genes, the latter were expressed at high levels. Chloramphenicol acetyltransferase activity was 400-600 times greater than that observed with conventional mammalian transient-expression systems regulated either by the enhancer and promoter regions of the Rous sarcoma virus long terminal repeat or by the simian virus 40 early region. The vaccinia/T7 hybrid virus forms the basis of a simple, rapid, widely applicable, and efficient mammalian expression system.},
   Au = {Moss B},
   Author = {Fuerst, T R and Niles, E G and Studier, F W and Moss, B},
   Da = {19861205},
   Date-Modified = {2006-06-06 09:03:49 -0400},
   Dcom = {19861205},
   Edat = {1986/11/01},
   Jid = {7505876},
   Journal = {Proc Natl Acad Sci U S A},
   Keywords = {Virtual Machines and Dedicated Synthesis and T7 RNAP},
   Language = {eng},
   Local-Url = {<file://localhost/Users/Barry/Desktop/Papers/Fuerst/Fuerst1986ko.pdf> file://localhost/Users/Barry/Desktop/Papers/Fuerst/Fuerst1986ko.pdf},
   Lr = {20021101},
   Mhda = {1986/11/01 00:01},
   Number = {21},
   Own = {NLM},
   Pages = {8122-6},
   Pl = {UNITED STATES},
   Pmid = {3095828},
   Pst = {ppublish},
   Pt = {Journal Article},
   Pubm = {Print},
   Rn = {EC <http://3.2.1.23>3.2.1.23 (beta-Galactosidase)},
   Sb = {IM},
   Stat = {MEDLINE},
   Title = {Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.},
   Volume = {83},
   Year = {1986}}

-- Barry Canton Endy Lab Biological Engineering Division Massachusetts Institute of Technology

Tel.:(617) 899 6062

Retrieved from "https://openwetware.org/mediawiki/index.php?title=User_talk:Nkuldell/mtDNA_pt2&oldid=50252"