User talk:Nkuldell/mtDNA pt3

From OpenWetWare
Revision as of 03:55, 27 June 2007 by Nkuldell (talk | contribs)
Jump to navigationJump to search

Experimental Details

PartI: mtRnt1p

A. deoxycycline-regulation of RNase expression

plasmid map for pCM224
  • regulation of expression from deoxycline-induced promoter, described in Herrero Yeast 1998 14(12):1127-38
  • sequence file for pCM224 which encodes tTA and CYC1-repressible promoter due to 2 copies of tetO
  • can excise relevant regulatory module (tTA driven by ADH1 and CYC1 with 2XtetO) on RI, BamHI fragment

B. pRS416

plasmid map for pRS416 with single cutters indicated
  • sequence file for pRS416
  • can clone tTA/CYC1tetO2/mtRNT1 into RI, BamHI bkb
  • pRS415 does not have unique EcoRI, though BamHI is unique
  • pRS414, pRS413 both have unique EcoRI, BamHI

C. mtRnt1

Steps to target RNT1 to mitochondrial matrix

  • 1. downloaded genomic sequence of RNT1 from SGD. RNT1/YMR239C on chromosome XIII from coordinates 749676 to 748261 on Crick (bottom) strand.
  • 2. removed EcoRI site from coding sequence of RNT1. Changed GAA(bp721-723)TTC(bp724-726) at Glu240Phe241 to GAG TTC which removed RI but keeps GluPhe.
    • sequence file for RNT1 genomic DNA with silent mutation to remove EcoRI
RNTI with silent mutations to remove EcoRI; restriction with favorite enzymes
    • Favorite Enzymes: AvaI, BamHI, BglII, EcoRI, HincII, HindIII, PstI, SmaI, XbaI, XmnI
  • 3. added mitochondrial targeting sequence from HEM1 to 5' end of RNT1
    • described as sufficient for mt localization of b-gal
    • does not change restriction analysis with favorite enzymes
    • sequence ATG CAA CGC TCC ATT TTT GCG AGG TTC/ Met Gln Arg Ser Ile Phe Ala Arg Phe
  • 4. removed nuclear localization signal from 3'end fo RNT1 gene
    • described as sufficient for nuclear localization of RNT1
    • removed AAG AAT AAG AAA AGA AAA TTC TCA GAT ACA AGC TGA/Lys Asn Lys Lys Asn Lys Phe Ser Asp Thr Ser, last 11 aa before stop codon, keeping stop codon
    • sequence file shows this variation does not have either an EcoRI or a BamHI site
    • other sites not in mtRNT1 that are in pRS416 polylinker after RI, Bam pair: SpeI, XbaI, NotI, EagI, AleI, SacII, BstXI, SacI
    • may want to order this sequence only since import to mt of bulky HA or charge myc may be problematic . Is there anything to be learned if - result seen w/o tag? Hydrophobicity predictor tool here. From Gottfried Schatz comment on (unpublished?) data at the end of this intro to mt in Ann Rev Biochem 2007: "the two proteins encoded by all mitochondrial DNAs, subunit I of cytochrome oxidase and cytochrome b, are precisely those that are exceptionally hydrophobic. Experiments with yeast cells designed to express reengineered versions of the two corresponding genes outside the mitochondria and to import the protein products back into mitochondria have so far failed, even though this approach worked well for some of the less hydrophobic mitochondrially made proteins." Choose bulky tag over hydrophobic?
  • 5. make a version with HA tag on C-terminus
    • HA= 9-amino acid sequence (YPYDVPDYA) recognized by the anti-12CA5 (=anti-HA)
    • reverse translate at |Gene Design
    • default settings gives sequence: TACCCATATGATGTTCCGGACTACGCT
  • 6. less likely to work seems version with myc tag on C-terminus
    • c-myc=10-amino acid sequence (EQKLISEEDL) recognized by anti-9E10 (=anti-myc)
    • reverse translate at |Gene Design
    • default settings gives sequence: GAACAGAAACTGATCTCTGAAGAAGACCTG
Retrieved from "https://openwetware.org/mediawiki/index.php?title=User_talk:Nkuldell/mtDNA_pt3&oldid=125892"