User talk:Nkuldell/mtDNA pt3
From OpenWetWare
Experimental Details
Matt and Barry's Project
Matt's notebook
mtGFP= JSC350X and parent strain DL2: 070307 strain from Tom Fox, 070607 photos from Matt Gethers...
PartI: mtRnt1p
Seq File 1. sequence file for synthesis order = mtRNT1 with:
- no internal EcoRI
- mt localization signal at 5' end
- no NLS at 3' end
- HA tag at 3' end
- 668 bp 5'UTR
- 500 bases after stop
- unique BamHI at 5' end, unique NotI at 3'end
Seq File 2. sequence file for modified mtRnt1
Seq File 3. sequence file for tTA+CYC1tetO2 from pCM224, RI to Bam
Seq File 4. sequence file for tTA+CYC1tetO2+mtRnt1+HA. Not ordered since cloned tTA/CYCI into pRS416 on RI/Bam frag.
A. mtRnt1
Steps to target RNT1 to mitochondrial matrix
- 1. downloaded genomic sequence of RNT1 from SGD. RNT1/YMR239C on chromosome XIII from coordinates 749676 to 748261 on Crick (bottom) strand.
- sequence file for RNT1 genomic DNA
- 2. removed EcoRI site from coding sequence of RNT1. Changed GAA(bp721-723)TTC(bp724-726) at Glu240Phe241 to GAG TTC which removed RI but keeps GluPhe.
- 3. added mitochondrial targeting sequence from HEM1 to 5' end of RNT1
- described as sufficient for mt localization of b-gal
- does not change restriction analysis with favorite enzymes
- sequence ATG CAA CGC TCC ATT TTT GCG AGG TTC/ Met Gln Arg Ser Ile Phe Ala Arg Phe
- 4. removed nuclear localization signal from 3'end fo RNT1 gene
- described as sufficient for nuclear localization of RNT1
- removed AAG AAT AAG AAA AGA AAA TTC TCA GAT ACA AGC TGA/Lys Asn Lys Lys Asn Lys Phe Ser Asp Thr Ser, last 11 aa before stop codon, keeping stop codon
- sequence file shows this variation does not have either an EcoRI or a BamHI site
- other sites not in mtRNT1 that are in pRS416 polylinker after RI, Bam pair: SpeI, XbaI, NotI, EagI, AleI, SacII, BstXI, SacI. NotI is missing from deoxycycline regulatory module and is present as unique site in polylinker of all pRS series.
- may want to order this sequence only since import to mt of bulky HA or charge myc may be problematic . Is there anything to be learned if - result seen w/o tag? Hydrophobicity predictor tool here. From Gottfried Schatz comment on (unpublished?) data at the end of this intro to mt in Ann Rev Biochem 2007: "the two proteins encoded by all mitochondrial DNAs, subunit I of cytochrome oxidase and cytochrome b, are precisely those that are exceptionally hydrophobic. Experiments with yeast cells designed to express reengineered versions of the two corresponding genes outside the mitochondria and to import the protein products back into mitochondria have so far failed, even though this approach worked well for some of the less hydrophobic mitochondrially made proteins." Choose bulky tag over hydrophobic?
- 5. make a version with HA tag on C-terminus
- HA= 9-amino acid sequence (YPYDVPDYA) recognized by the anti-12CA5 (=anti-HA)
- reverse translate at |Gene Design
- default settings gives sequence: TACCCATATGATGTTCCGGACTACGCT
- sequence file for mtRNT1+HA (=RNT1_noRI+mtSTS-NLS+HA)
- 6. add cloning sites: BamHI at 5' end and NotI at 3' end
- sequence file with HA tag and cloning ends. 06.27.07 asked for quotes and timelines from DNA 2.0, GeneArt and BlueHeron. But then...
- 7. Change of heart on 5' and 3' UTR...
- from Marek Skrzypek at SGD learned: "Unfortunately, SGD doesn't have transcript start and stop information for all the ORFs. We do have data on some transcription start sites reported in Zhang Z and Dietrich FS (2005) Nucleic Acids Res 33:2838 and cDNA clones reported in Miura F et al. (2006) Proc Natl Acad Sci U S A 103:17846. They can be viewed in the Genome Browser. Click on the GBrowse thumbnail on the right side of the Locus page to open the browser window. To view these data, select the "cDNA transcripts" and "Transcription start sites" tracks and press the "Update Image" button. If you do not see those tracks, select the red "Reset" button. Once you have identified the region you want, you can download the sequence using the Reports & Analysis pulldown menu of Gbrowse. I just checked and we do have data for RNT1. Hopefully, you will be able to find other sequences as well."
- this process shows 668 bases included at 5' UTR. Translation gives additional 135 aa translation product upstream of RNT1 ATG. Several internal in frame of this 135 aa upstream protein.
- pasted to NEB cutter to find this sequence has no RI, BamHI or NotI sequences but translation of these 668 generate 135 aa protein. Also see unexpectedly long mtRNT1+HA (551aa rather than expected 479aa) but this discrepency not seen in Genchek.
- no info at SGD on 3'UTR to go for 500 bp, which also has no RI, Bam or NotI sites. This gives short (39aa) downstream translation product using TGA start codon if it's still there after processing.
- added ~668 bases upstream of ATG and 500 bp downstream of TGA but before NotI site.
- sequence file for final mtRNT1 (no RI site within, mt signal target sequence at N-term, no NLS at C-term, HA at C-term, 668 bp 5'UTR, 500 bases included downtream of stop codon, flanked by unique BamHI at 5' end and unique NotI at 3' end...whew!).
- Kyte-Doolittle predicted hydrophobicity plot, where values above 0 are hydrophobic in character, suggests protein is not overall hydrophobic and leaves hope for mt import.
B. deoxycycline-regulation of RNase expression
- regulation of expression from deoxycline-induced promoter, described in Herrero Yeast 1998 14(12):1127-38
- sequence file for pCM224 which encodes tTA and CYC1-repressible promoter due to 2 copies of tetO
- can excise relevant regulatory module (tTA driven by ADH1 and CYC1 with 2XtetO) on RI, BamHI fragment
- sequence file for RI to Bam
C. pRS416
- sequence file for pRS416
- can clone tTA/CYC1tetO2 into RI, BamHI bkb
- can clone tTA/CYC1tetO2/mtRNTI into RI, NotI bkb
- pRS415 does not have unique EcoRI, though BamHI and NotI are unique
- pRS414, pRS413 both have unique EcoRI, BamHI and NotI in polylinkers
