User talk:Yanjia Jason Zhang

Hello, Yanjia Jason Zhang! This is a welcome message from OpenWetWare. By the way, we've announced you on the home page! You can leave messages to any OWW member by editing their User_talk pages like this one. And don't forget to personalize your User Page so that we can get to know you better! We've included some tips below to get you started.

Basic Wiki Instructions

• Don't be afraid to edit! As with all pages on the wiki, all versions are saved so its easy to undo. If you have any questions feel free to send us an email.

1. Start off by clicking the 'edit' button to the right of this section, or at the top of the page.
2. Now you should see the text of this section as text within an editor box. There are several buttons in the editor box, but don't worry about those for now. Just type something in the box, scroll down to the bottom, and hit the 'Preview' button.
3. You should see the web-page and text box views, but now with your edits! Don't forget to save your changes by clicking 'Save Page'!
4. Editing pages is as easy as that. There are of course many ways to format your text. The easiest way to learn is to find an OWW page with the formatting you like, click on the edit button again, and see for yourself how it was created in the text box. Here's an extensive list of formating examples. Or look at this OpenWetWare introductory tutorial.
5. When you are done, remove these instructions by clicking the edit button for this section again, erase everything you see in the text box and click 'Save Page'. (And remember you can always retrieve these by clicking on the 'history' tab at the top of this page.)

Note that these instructions apply to any page on OWW. Feel free to contribute to OWW by editing pages to add content, update them, or even correct mistakes. OWW relies on an active community to manage our growing resource of open access information, and we need your help!

Personal/Lab Info

We have gone ahead and filled in some information you provided us in your membership application on your User Page. Please take a moment to embellish this and tell the community a little more about you. Put links to your lab pages, your projects and your interests. If you run out of ideas, take a look at some of the other User pages. For example, check out User:Julius_B._Lucks, User:Jason_R._Kelly and User:Reshma_P._Shetty.

You'll also notice that we have put an 'image' placeholder at the top of your User Page. We encourage you to upload an image of yourself to give OWW a more personal feel. To upload an image, click on the Upload file link on the left-hand side (toolbar). Choose a file from your computer, and remember the file name. After you have uploaded the image, you should see it loaded on its own page. Go back to your User Page, click on edit, and replace 'OWWEmblem.png' with the name of your file that you have uploaded in the second line of this page.

Assignment #2

Exponential Curve

Python Code:

   import numpy as np
   import matplotlib.pyplot as plt
   a,b,c,d,k=1,1,[0],[0],0.8
   while a < 100:
       c.insert(len(c),a)
       d.insert(len(c),b)
       a=a+1
       b=b*k
   print c
   print d
   plt.plot(c,d,'bo')
   plt.show()

If anyone has comments, especially tips on how to make multiple curves on the matplot platform, I'd love to hear them! I have not programmed in more than a decade, so any comments are more than welcome.

Python Graphs: 1.) k=0.9

2.) k=1.1

Excel Graphs:

Notes:

• when k<1, the curve is negatively sloped
• when k>1, the curve is positively sloped
• any small change in k gets amplified greatly

Assignment #3

Biophysics 101, Fall 2009

Assignment 3

Due: 9/24/2009 6:00 PM

Please use python to answer the following questions. Include your script in your assignment and any output you get from the script/commands.

p53 (protein 53) is an important cell regulator and a suppressor of tumor growth in the prevention of cancer. Below is a segment of the p53 gene (GenBank # X54156.1)

p53seg cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttag gccggttcctcttacttggcagagggaggctgctattctccgcctgcatttctttttctg gattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatc cctccccttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgc taccatggcgtagacagggagggaaagaagtgtgcagaaggcaagcccggaggcactttc aagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaat gaaattttgaaagagtgcaatgatgggtcgtttgataatttgtcgggaaaaacaatctac ctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtcgtgaag cggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccg gttcttcctggtaggaggcggaactcgaattcatttctcccgctgccccatctcttagct cgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtg ccgtacttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcac acagcaagtgcacaggaagatgagttttggcccctaaccgctccgtgatgcctaccaagt cacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccg accccacctttattttgatctccataaccattttgcctgttggagaacttcatatagaat ggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcactttggga ggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg

1. GC content is the % of G and C nucleotides in a sequence and is a marker to distinguish genomes among various organisms. Please determine the GC content of p53seg.

2. The reverse complement of a DNA sequence is the DNA sequence reversed and then taken with its complementary base pairs. For example, the reverse complement of the sequence ATGGGCCT is AGGCCCAT. Determine the DNA reverse complement of p53seg.

3. To determine the protein sequence from the DNA sequence, use the standard codon table below to convert the tri-nucleotide sequences (codon) to its one letter amino acid representative. Note: “*” means stop codon.

standard = { 'ttt': 'F', 'tct': 'S', 'tat': 'Y', 'tgt': 'C', 'ttc': 'F', 'tcc': 'S', 'tac': 'Y', 'tgc': 'C', 'tta': 'L', 'tca': 'S', 'taa': '*', 'tga': '*', 'ttg': 'L', 'tcg': 'S', 'tag': '*', 'tgg': 'W',

'ctt': 'L', 'cct': 'P', 'cat': 'H', 'cgt': 'R', 'ctc': 'L', 'ccc': 'P', 'cac': 'H', 'cgc': 'R', 'cta': 'L', 'cca': 'P', 'caa': 'Q', 'cga': 'R', 'ctg': 'L', 'ccg': 'P', 'cag': 'Q', 'cgg': 'R',

		'att': 'I', 'act': 'T', 'aat': 'N', 'agt': 'S',
		'atc': 'I', 'acc': 'T', 'aac': 'N', 'agc': 'S',

'ata': 'I', 'aca': 'T', 'aaa': 'K', 'aga': 'R',

 		'atg': 'M', 'acg': 'T', 'aag': 'K', 'agg': 'R',

'gtt': 'V', 'gct': 'A', 'gat': 'D', 'ggt': 'G', 'gtc': 'V', 'gcc': 'A', 'gac': 'D', 'ggc': 'G', 'gta': 'V', 'gca': 'A', 'gaa': 'E', 'gga': 'G', 'gtg': 'V', 'gcg': 'A', 'gag': 'E', 'ggg': 'G' }

Translate the p53seg gene into its protein sequence in all 6 frames (+1, +2, +3, -1, -2, -3), that is, starting with

(+1) frame: cgg agc agc … (+2) frame: gga gca gct … (+3) frame: gag cag ctc … Reverse complement frame: (-1) frame: cac cac gtt … (-2) frame: acc acg ttg … (-3) frame: cca cgt tgg …

4. Mutations in a gene can lead to changes in the protein sequence. This can occur in many different ways including the insertion of nucleotides, loss of nucleotides, or the conversion of one sequence to another. For example in sickle-cell disease, the replacement of A by T at the 17th nucleotide of the gene for the β-chain of hemoglobin changes the codon GAG (for glutamic acid) to GTG (which encodes valine), leading to the 6th amino acid in the protein being converted to valine instead of glutamic acid. Please introduce single base-pair mutations (i.e. replacement of A by T/C/G, G by A/T/C, etc…) to the p53seg gene at a rate of 1% (i.e. ~1 mutation every 100 base pairs) and document the changes to the protein sequence (give a couple of trial results). How often do you see premature terminations?