Van Oudenaarden Lab:T01D3.2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 28: Line 28:
--------------------------
--------------------------
Name of probe set: hlh-34
Name of probe set: hlh-34
 +
Probes designed on Wed, 03 Mar 10 23:49:08 -0700
Probes designed on Wed, 03 Mar 10 23:49:08 -0700
 +
40 probes designed for target of length 969
40 probes designed for target of length 969
Line 34: Line 36:
cttcagaaagattagtctcc, hlh-34_1, 1, 3, 40
cttcagaaagattagtctcc, hlh-34_1, 1, 3, 40
 +
ggcttgtgattttgacggtt, hlh-34_2, 2, 32, 45
ggcttgtgattttgacggtt, hlh-34_2, 2, 32, 45
 +
tttccatttgtcttctctgc, hlh-34_3, 3, 54, 40
tttccatttgtcttctctgc, hlh-34_3, 3, 54, 40
 +
ggctagctgtgagaattcat, hlh-34_4, 4, 77, 45
ggctagctgtgagaattcat, hlh-34_4, 4, 77, 45
 +
ctcttgccaatggaagttca, hlh-34_5, 5, 99, 45
ctcttgccaatggaagttca, hlh-34_5, 5, 99, 45
 +
tcaatatgctgtccagaaat, hlh-34_6, 6, 121, 35
tcaatatgctgtccagaaat, hlh-34_6, 6, 121, 35
 +
gctaatctaaccatcgttgt, hlh-34_7, 7, 145, 40
gctaatctaaccatcgttgt, hlh-34_7, 7, 145, 40
 +
gtgaagtttgatataagcag, hlh-34_8, 8, 167, 35
gtgaagtttgatataagcag, hlh-34_8, 8, 167, 35
 +
ctttgagattgcccaaatat, hlh-34_9, 9, 190, 35
ctttgagattgcccaaatat, hlh-34_9, 9, 190, 35
 +
atagtcagctgaactgtagg, hlh-34_10, 10, 212, 45
atagtcagctgaactgtagg, hlh-34_10, 10, 212, 45
 +
gtccataaagagtcacttcc, hlh-34_11, 11, 238, 45
gtccataaagagtcacttcc, hlh-34_11, 11, 238, 45
 +
ccatctagtagatctaaatg, hlh-34_12, 12, 265, 35
ccatctagtagatctaaatg, hlh-34_12, 12, 265, 35
 +
cctgtccagtatcacaaaga, hlh-34_13, 13, 287, 45
cctgtccagtatcacaaaga, hlh-34_13, 13, 287, 45
 +
ttatgtaaagtacatctccg, hlh-34_14, 14, 309, 35
ttatgtaaagtacatctccg, hlh-34_14, 14, 309, 35
 +
gcccaagtaaatactaatag, hlh-34_15, 15, 335, 35
gcccaagtaaatactaatag, hlh-34_15, 15, 335, 35
 +
gccagtcatttcaacttgtg, hlh-34_16, 16, 359, 45
gccagtcatttcaacttgtg, hlh-34_16, 16, 359, 45
 +
gaatataatcaaccatcgcg, hlh-34_17, 17, 381, 40
gaatataatcaaccatcgcg, hlh-34_17, 17, 381, 40
 +
aagcaattgatatcctgttc, hlh-34_18, 18, 403, 35
aagcaattgatatcctgttc, hlh-34_18, 18, 403, 35
 +
acaatagttaagggccgagt, hlh-34_19, 19, 425, 45
acaatagttaagggccgagt, hlh-34_19, 19, 425, 45
 +
acatttgaggccaattaagg, hlh-34_20, 20, 447, 40
acatttgaggccaattaagg, hlh-34_20, 20, 447, 40
 +
gactagatttaacacgtacg, hlh-34_21, 21, 471, 40
gactagatttaacacgtacg, hlh-34_21, 21, 471, 40
 +
tccttgtttgctcgctttgt, hlh-34_22, 22, 493, 45
tccttgtttgctcgctttgt, hlh-34_22, 22, 493, 45
 +
tccaggtgaagcacgaactg, hlh-34_23, 23, 515, 55
tccaggtgaagcacgaactg, hlh-34_23, 23, 515, 55
 +
tttctagacgaagaaccttg, hlh-34_24, 24, 537, 40
tttctagacgaagaaccttg, hlh-34_24, 24, 537, 40
 +
tttgtatttggacccattgt, hlh-34_25, 25, 559, 35
tttgtatttggacccattgt, hlh-34_25, 25, 559, 35
 +
ggataacatgcaatcattct, hlh-34_26, 26, 583, 35
ggataacatgcaatcattct, hlh-34_26, 26, 583, 35
 +
agaaagaactggagtaggca, hlh-34_27, 27, 605, 45
agaaagaactggagtaggca, hlh-34_27, 27, 605, 45
 +
gaattagaaggaatggttac, hlh-34_28, 28, 628, 35
gaattagaaggaatggttac, hlh-34_28, 28, 628, 35
 +
gaagatcgatggatgtaatg, hlh-34_29, 29, 657, 40
gaagatcgatggatgtaatg, hlh-34_29, 29, 657, 40
 +
gatgagctttttcatcagca, hlh-34_30, 30, 687, 40
gatgagctttttcatcagca, hlh-34_30, 30, 687, 40
 +
gaatctgggtaaaatgggtt, hlh-34_31, 31, 718, 40
gaatctgggtaaaatgggtt, hlh-34_31, 31, 718, 40
 +
gtgaatataatgacattcct, hlh-34_32, 32, 747, 30
gtgaatataatgacattcct, hlh-34_32, 32, 747, 30
 +
cttcagaatctgagatatca, hlh-34_33, 33, 771, 35
cttcagaatctgagatatca, hlh-34_33, 33, 771, 35
 +
ggttgaaaatatcgaaatgc, hlh-34_34, 34, 804, 35
ggttgaaaatatcgaaatgc, hlh-34_34, 34, 804, 35
 +
agtacggggttttataagcg, hlh-34_35, 35, 828, 45
agtacggggttttataagcg, hlh-34_35, 35, 828, 45
 +
gtttgattcaagatcattcg, hlh-34_36, 36, 850, 35
gtttgattcaagatcattcg, hlh-34_36, 36, 850, 35
 +
ctcgacgtaaaaagtttcac, hlh-34_37, 37, 872, 40
ctcgacgtaaaaagtttcac, hlh-34_37, 37, 872, 40
 +
gaaatcgaagtatgacgaaa, hlh-34_38, 38, 901, 35
gaaatcgaagtatgacgaaa, hlh-34_38, 38, 901, 35
 +
cgagtcattaaactgtttag, hlh-34_39, 39, 923, 35
cgagtcattaaactgtttag, hlh-34_39, 39, 923, 35
 +
gaattgaggaaacaaatgtg, hlh-34_40, 40, 945, 35
gaattgaggaaacaaatgtg, hlh-34_40, 40, 945, 35
 +
----------------------------------------------------------------------
----------------------------------------------------------------------
Input sequence with probe locations:
Input sequence with probe locations:

Revision as of 23:57, 5 March 2010

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>T01D3.2 (spliced + UTR - 985) gagaaATGGA GACTAATCTT TCTGAAGAAA AACAAAAACC GTCAAAATCA CAAGCCCAGC AGAGAAGACA AATGGAAAAT TATGAATTCT CACAGCTAGC CAATGAACTT CCATTGGCAA GAGCAATTTC TGGACAGCAT ATTGATAAAA CAACGATGGT TAGATTAGCA ACTGCTTATA TCAAACTTCA CAATATATTT GGGCAATCTC AAAGAGCCTA CAGTTCAGCT GACTATTATT ATGGAAGTGA CTCTTTATGG ACTAACAATC ATTTAGATCT ACTAGATGGA TTCTTTGTGA TACTGGACAG GCGCGGAGAT GTACTTTACA TAAGTGAAAC TATTAGTATT TACTTGGGCT TGTCACAAGT TGAAATGACT GGCAACGCGA TGGTTGATTA TATTCATGAA CAGGATATCA ATTGCTTTAA CTCGGCCCTT AACTATTGTG ACCTTAATTG GCCTCAAATG TGCAACGTAC GTGTTAAATC TAGTCTCACA AAGCGAGCAA ACAAGGATGC AGTTCGTGCT TCACCTGGAT ACAAGGTTCT TCGTCTAGAA ATTACAATGG GTCCAAATAC AAATACTAGA ATGATTGCAT GTTATCCAAT GCCTACTCCA GTTCTTTCTA CAGTAACCAT TCCTTCTAAT TCATTTGTTA TCATTACATC CATCGATCTT CATATAACAT TTGCTGATGA AAAAGCTCAT CAGTTGCTTA ATAACCCATT TTACCCAGAT TCAAATATCA AAGGAATGTC ATTATATTCA CTGATTGATA TCTCAGATTC TGAAGTTATA TCAAAAATGC ATTTCGATAT TTTCAACCTG GGCGCTTATA AAACCCCGTA CTATCGAATG ATCTTGAATC AAACAAGTGA AACTTTTTAC GTCGAGTCAA ATATTTTTCG TCATACTTCG ATTTCCTCTA AACAGTTTAA TGACTCGATC ACATTTGTTT CCTCAATTCT ATGAcctcca acttt


Name of probe set: hlh-34

Probes designed on Wed, 03 Mar 10 23:49:08 -0700

40 probes designed for target of length 969

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

cttcagaaagattagtctcc, hlh-34_1, 1, 3, 40

ggcttgtgattttgacggtt, hlh-34_2, 2, 32, 45

tttccatttgtcttctctgc, hlh-34_3, 3, 54, 40

ggctagctgtgagaattcat, hlh-34_4, 4, 77, 45

ctcttgccaatggaagttca, hlh-34_5, 5, 99, 45

tcaatatgctgtccagaaat, hlh-34_6, 6, 121, 35

gctaatctaaccatcgttgt, hlh-34_7, 7, 145, 40

gtgaagtttgatataagcag, hlh-34_8, 8, 167, 35

ctttgagattgcccaaatat, hlh-34_9, 9, 190, 35

atagtcagctgaactgtagg, hlh-34_10, 10, 212, 45

gtccataaagagtcacttcc, hlh-34_11, 11, 238, 45

ccatctagtagatctaaatg, hlh-34_12, 12, 265, 35

cctgtccagtatcacaaaga, hlh-34_13, 13, 287, 45

ttatgtaaagtacatctccg, hlh-34_14, 14, 309, 35

gcccaagtaaatactaatag, hlh-34_15, 15, 335, 35

gccagtcatttcaacttgtg, hlh-34_16, 16, 359, 45

gaatataatcaaccatcgcg, hlh-34_17, 17, 381, 40

aagcaattgatatcctgttc, hlh-34_18, 18, 403, 35

acaatagttaagggccgagt, hlh-34_19, 19, 425, 45

acatttgaggccaattaagg, hlh-34_20, 20, 447, 40

gactagatttaacacgtacg, hlh-34_21, 21, 471, 40

tccttgtttgctcgctttgt, hlh-34_22, 22, 493, 45

tccaggtgaagcacgaactg, hlh-34_23, 23, 515, 55

tttctagacgaagaaccttg, hlh-34_24, 24, 537, 40

tttgtatttggacccattgt, hlh-34_25, 25, 559, 35

ggataacatgcaatcattct, hlh-34_26, 26, 583, 35

agaaagaactggagtaggca, hlh-34_27, 27, 605, 45

gaattagaaggaatggttac, hlh-34_28, 28, 628, 35

gaagatcgatggatgtaatg, hlh-34_29, 29, 657, 40

gatgagctttttcatcagca, hlh-34_30, 30, 687, 40

gaatctgggtaaaatgggtt, hlh-34_31, 31, 718, 40

gtgaatataatgacattcct, hlh-34_32, 32, 747, 30

cttcagaatctgagatatca, hlh-34_33, 33, 771, 35

ggttgaaaatatcgaaatgc, hlh-34_34, 34, 804, 35

agtacggggttttataagcg, hlh-34_35, 35, 828, 45

gtttgattcaagatcattcg, hlh-34_36, 36, 850, 35

ctcgacgtaaaaagtttcac, hlh-34_37, 37, 872, 40

gaaatcgaagtatgacgaaa, hlh-34_38, 38, 901, 35

cgagtcattaaactgtttag, hlh-34_39, 39, 923, 35

gaattgaggaaacaaatgtg, hlh-34_40, 40, 945, 35


Input sequence with probe locations:


atggagactaatctttctgaagaaaaacaaaaaccgtcaaaatcacaagcccagcagagaagacaaatgg

 cctctgattagaaagacttc         ttggcagttttagtgttcgg  cgtctcttctgtttacc
 Probe # 1, 40% GC            Probe # 2, 45% GC     Probe # 3, 40% GC

aaaattatgaattctcacagctagccaatgaacttccattggcaagagcaatttctggacagcatattga ttt tacttaagagtgtcgatcgg acttgaaggtaaccgttctc taaagacctgtcgtataact

     Probe # 4, 45% GC     Probe # 5, 45% GC     Probe # 6, 35% GC   

taaaacaacgatggttagattagcaactgcttatatcaaacttcacaatatatttgggcaatctcaaaga

   tgttgctaccaatctaatcg  gacgaatatagtttgaagtg   tataaacccgttagagtttc 
   Probe # 7, 40% GC     Probe # 8, 35% GC      Probe # 9, 35% GC    

gcctacagttcagctgactattattatggaagtgactctttatggactaacaatcatttagatctactag

ggatgtcaagtcgactgata      ccttcactgagaaatacctg       gtaaatctagatgatc
Probe # 10, 45% GC        Probe # 11, 45% GC         Probe # 12, 35% 

atggattctttgtgatactggacaggcgcggagatgtactttacataagtgaaactattagtatttactt tacc agaaacactatgacctgtcc gcctctacatgaaatgtatt gataatcataaatgaa GC Probe # 13, 45% GC Probe # 14, 35% GC Probe # 15, 35%

gggcttgtcacaagttgaaatgactggcaacgcgatggttgattatattcatgaacaggatatcaattgc cccg gtgttcaactttactgaccg gcgctaccaactaatataag cttgtcctatagttaacg GC Probe # 16, 45% GC Probe # 17, 40% GC Probe # 18, 35% GC

tttaactcggcccttaactattgtgaccttaattggcctcaaatgtgcaacgtacgtgttaaatctagtc aa tgagccgggaattgataaca ggaattaaccggagtttaca gcatgcacaatttagatcag

   Probe # 19, 45% GC    Probe # 20, 40% GC      Probe # 21, 40% GC  

tcacaaagcgagcaaacaaggatgcagttcgtgcttcacctggatacaaggttcttcgtctagaaattac

 tgtttcgctcgtttgttcct  gtcaagcacgaagtggacct  gttccaagaagcagatcttt  tg
 Probe # 22, 45% GC    Probe # 23, 55% GC    Probe # 24, 40% GC    Pr

aatgggtccaaatacaaatactagaatgattgcatgttatccaatgcctactccagttctttctacagta ttacccaggtttatgttt tcttactaacgtacaatagg acggatgaggtcaagaaaga cat obe # 25, 35% GC Probe # 26, 35% GC Probe # 27, 45% GC Pro

accattccttctaattcatttgttatcattacatccatcgatcttcatataacatttgctgatgaaaaag tggtaaggaagattaag gtaatgtaggtagctagaag acgactactttttc be # 28, 35% GC Probe # 29, 40% GC Probe # 30, 40

ctcatcagttgcttaataacccattttacccagattcaaatatcaaaggaatgtcattatattcactgat gagtag ttgggtaaaatgggtctaag tccttacagtaatataagtg % GC Probe # 31, 40% GC Probe # 32, 30% GC

tgatatctcagattctgaagttatatcaaaaatgcatttcgatattttcaacctgggcgcttataaaacc actatagagtctaagacttc cgtaaagctataaaagttgg gcgaatattttgg Probe # 33, 35% GC Probe # 34, 35% GC Probe # 35, 4

ccgtactatcgaatgatcttgaatcaaacaagtgaaactttttacgtcgagtcaaatatttttcgtcata ggcatga gcttactagaacttagtttg cactttgaaaaatgcagctc aaagcagtat 5% GC Probe # 36, 35% GC Probe # 37, 40% GC Probe # 38

cttcgatttcctctaaacagtttaatgactcgatcacatttgtttcctcaattctatga gaagctaaag gatttgtcaaattactgagc gtgtaaacaaaggagttaag , 35% GC Probe # 39, 35% GC Probe # 40, 35% GC

Personal tools