Van Oudenaarden Lab:T01D3.2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (22:57, 5 March 2010) (view source)
 
Line 114: Line 114:
gaattgaggaaacaaatgtg, hlh-34_40, 40, 945, 35
gaattgaggaaacaaatgtg, hlh-34_40, 40, 945, 35
-
 
-
----------------------------------------------------------------------
 
-
Input sequence with probe locations:
 
-
 
-
 
-
atggagactaatctttctgaagaaaaacaaaaaccgtcaaaatcacaagcccagcagagaagacaaatgg
 
-
  cctctgattagaaagacttc        ttggcagttttagtgttcgg  cgtctcttctgtttacc
 
-
  Probe # 1, 40% GC            Probe # 2, 45% GC    Probe # 3, 40% GC
 
-
 
-
aaaattatgaattctcacagctagccaatgaacttccattggcaagagcaatttctggacagcatattga
 
-
ttt  tacttaagagtgtcgatcgg  acttgaaggtaaccgttctc  taaagacctgtcgtataact
 
-
      Probe # 4, 45% GC    Probe # 5, 45% GC    Probe # 6, 35% GC 
 
-
 
-
taaaacaacgatggttagattagcaactgcttatatcaaacttcacaatatatttgggcaatctcaaaga
 
-
    tgttgctaccaatctaatcg  gacgaatatagtttgaagtg  tataaacccgttagagtttc
 
-
    Probe # 7, 40% GC    Probe # 8, 35% GC      Probe # 9, 35% GC   
 
-
 
-
gcctacagttcagctgactattattatggaagtgactctttatggactaacaatcatttagatctactag
 
-
ggatgtcaagtcgactgata      ccttcactgagaaatacctg      gtaaatctagatgatc
 
-
Probe # 10, 45% GC        Probe # 11, 45% GC        Probe # 12, 35%
 
-
 
-
atggattctttgtgatactggacaggcgcggagatgtactttacataagtgaaactattagtatttactt
 
-
tacc  agaaacactatgacctgtcc  gcctctacatgaaatgtatt      gataatcataaatgaa
 
-
GC    Probe # 13, 45% GC    Probe # 14, 35% GC        Probe # 15, 35%
 
-
 
-
gggcttgtcacaagttgaaatgactggcaacgcgatggttgattatattcatgaacaggatatcaattgc
 
-
cccg    gtgttcaactttactgaccg  gcgctaccaactaatataag  cttgtcctatagttaacg
 
-
GC      Probe # 16, 45% GC    Probe # 17, 40% GC    Probe # 18, 35% GC
 
-
 
-
tttaactcggcccttaactattgtgaccttaattggcctcaaatgtgcaacgtacgtgttaaatctagtc
 
-
aa  tgagccgggaattgataaca  ggaattaaccggagtttaca    gcatgcacaatttagatcag
 
-
    Probe # 19, 45% GC    Probe # 20, 40% GC      Probe # 21, 40% GC 
 
-
 
-
tcacaaagcgagcaaacaaggatgcagttcgtgcttcacctggatacaaggttcttcgtctagaaattac
 
-
  tgtttcgctcgtttgttcct  gtcaagcacgaagtggacct  gttccaagaagcagatcttt  tg
 
-
  Probe # 22, 45% GC    Probe # 23, 55% GC    Probe # 24, 40% GC    Pr
 
-
 
-
aatgggtccaaatacaaatactagaatgattgcatgttatccaatgcctactccagttctttctacagta
 
-
ttacccaggtttatgttt    tcttactaacgtacaatagg  acggatgaggtcaagaaaga  cat
 
-
obe # 25, 35% GC      Probe # 26, 35% GC    Probe # 27, 45% GC    Pro
 
-
 
-
accattccttctaattcatttgttatcattacatccatcgatcttcatataacatttgctgatgaaaaag
 
-
tggtaaggaagattaag        gtaatgtaggtagctagaag          acgactactttttc
 
-
be # 28, 35% GC          Probe # 29, 40% GC            Probe # 30, 40
 
-
 
-
ctcatcagttgcttaataacccattttacccagattcaaatatcaaaggaatgtcattatattcactgat
 
-
gagtag          ttgggtaaaatgggtctaag        tccttacagtaatataagtg   
 
-
% GC            Probe # 31, 40% GC          Probe # 32, 30% GC     
 
-
 
-
tgatatctcagattctgaagttatatcaaaaatgcatttcgatattttcaacctgggcgcttataaaacc
 
-
actatagagtctaagacttc            cgtaaagctataaaagttgg    gcgaatattttgg
 
-
Probe # 33, 35% GC              Probe # 34, 35% GC      Probe # 35, 4
 
-
 
-
ccgtactatcgaatgatcttgaatcaaacaagtgaaactttttacgtcgagtcaaatatttttcgtcata
 
-
ggcatga  gcttactagaacttagtttg  cactttgaaaaatgcagctc        aaagcagtat
 
-
5% GC    Probe # 36, 35% GC    Probe # 37, 40% GC          Probe # 38
 
-
 
-
cttcgatttcctctaaacagtttaatgactcgatcacatttgtttcctcaattctatga
 
-
gaagctaaag  gatttgtcaaattactgagc  gtgtaaacaaaggagttaag   
 
-
, 35% GC    Probe # 39, 35% GC    Probe # 40, 35% GC
 

Current revision

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>T01D3.2 (spliced + UTR - 985) gagaaATGGA GACTAATCTT TCTGAAGAAA AACAAAAACC GTCAAAATCA CAAGCCCAGC AGAGAAGACA AATGGAAAAT TATGAATTCT CACAGCTAGC CAATGAACTT CCATTGGCAA GAGCAATTTC TGGACAGCAT ATTGATAAAA CAACGATGGT TAGATTAGCA ACTGCTTATA TCAAACTTCA CAATATATTT GGGCAATCTC AAAGAGCCTA CAGTTCAGCT GACTATTATT ATGGAAGTGA CTCTTTATGG ACTAACAATC ATTTAGATCT ACTAGATGGA TTCTTTGTGA TACTGGACAG GCGCGGAGAT GTACTTTACA TAAGTGAAAC TATTAGTATT TACTTGGGCT TGTCACAAGT TGAAATGACT GGCAACGCGA TGGTTGATTA TATTCATGAA CAGGATATCA ATTGCTTTAA CTCGGCCCTT AACTATTGTG ACCTTAATTG GCCTCAAATG TGCAACGTAC GTGTTAAATC TAGTCTCACA AAGCGAGCAA ACAAGGATGC AGTTCGTGCT TCACCTGGAT ACAAGGTTCT TCGTCTAGAA ATTACAATGG GTCCAAATAC AAATACTAGA ATGATTGCAT GTTATCCAAT GCCTACTCCA GTTCTTTCTA CAGTAACCAT TCCTTCTAAT TCATTTGTTA TCATTACATC CATCGATCTT CATATAACAT TTGCTGATGA AAAAGCTCAT CAGTTGCTTA ATAACCCATT TTACCCAGAT TCAAATATCA AAGGAATGTC ATTATATTCA CTGATTGATA TCTCAGATTC TGAAGTTATA TCAAAAATGC ATTTCGATAT TTTCAACCTG GGCGCTTATA AAACCCCGTA CTATCGAATG ATCTTGAATC AAACAAGTGA AACTTTTTAC GTCGAGTCAA ATATTTTTCG TCATACTTCG ATTTCCTCTA AACAGTTTAA TGACTCGATC ACATTTGTTT CCTCAATTCT ATGAcctcca acttt


Name of probe set: hlh-34

Probes designed on Wed, 03 Mar 10 23:49:08 -0700

40 probes designed for target of length 969

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

cttcagaaagattagtctcc, hlh-34_1, 1, 3, 40

ggcttgtgattttgacggtt, hlh-34_2, 2, 32, 45

tttccatttgtcttctctgc, hlh-34_3, 3, 54, 40

ggctagctgtgagaattcat, hlh-34_4, 4, 77, 45

ctcttgccaatggaagttca, hlh-34_5, 5, 99, 45

tcaatatgctgtccagaaat, hlh-34_6, 6, 121, 35

gctaatctaaccatcgttgt, hlh-34_7, 7, 145, 40

gtgaagtttgatataagcag, hlh-34_8, 8, 167, 35

ctttgagattgcccaaatat, hlh-34_9, 9, 190, 35

atagtcagctgaactgtagg, hlh-34_10, 10, 212, 45

gtccataaagagtcacttcc, hlh-34_11, 11, 238, 45

ccatctagtagatctaaatg, hlh-34_12, 12, 265, 35

cctgtccagtatcacaaaga, hlh-34_13, 13, 287, 45

ttatgtaaagtacatctccg, hlh-34_14, 14, 309, 35

gcccaagtaaatactaatag, hlh-34_15, 15, 335, 35

gccagtcatttcaacttgtg, hlh-34_16, 16, 359, 45

gaatataatcaaccatcgcg, hlh-34_17, 17, 381, 40

aagcaattgatatcctgttc, hlh-34_18, 18, 403, 35

acaatagttaagggccgagt, hlh-34_19, 19, 425, 45

acatttgaggccaattaagg, hlh-34_20, 20, 447, 40

gactagatttaacacgtacg, hlh-34_21, 21, 471, 40

tccttgtttgctcgctttgt, hlh-34_22, 22, 493, 45

tccaggtgaagcacgaactg, hlh-34_23, 23, 515, 55

tttctagacgaagaaccttg, hlh-34_24, 24, 537, 40

tttgtatttggacccattgt, hlh-34_25, 25, 559, 35

ggataacatgcaatcattct, hlh-34_26, 26, 583, 35

agaaagaactggagtaggca, hlh-34_27, 27, 605, 45

gaattagaaggaatggttac, hlh-34_28, 28, 628, 35

gaagatcgatggatgtaatg, hlh-34_29, 29, 657, 40

gatgagctttttcatcagca, hlh-34_30, 30, 687, 40

gaatctgggtaaaatgggtt, hlh-34_31, 31, 718, 40

gtgaatataatgacattcct, hlh-34_32, 32, 747, 30

cttcagaatctgagatatca, hlh-34_33, 33, 771, 35

ggttgaaaatatcgaaatgc, hlh-34_34, 34, 804, 35

agtacggggttttataagcg, hlh-34_35, 35, 828, 45

gtttgattcaagatcattcg, hlh-34_36, 36, 850, 35

ctcgacgtaaaaagtttcac, hlh-34_37, 37, 872, 40

gaaatcgaagtatgacgaaa, hlh-34_38, 38, 901, 35

cgagtcattaaactgtttag, hlh-34_39, 39, 923, 35

gaattgaggaaacaaatgtg, hlh-34_40, 40, 945, 35

Personal tools