Van Oudenaarden Lab:ZC247.3

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (22:56, 5 March 2010) (view source)
 
Line 1: Line 1:
Progress:
Progress:
-
Probes designed: (3-04-2010 - Ni Ji)
+
Probes designed: (03-04-2010 - Ni Ji)
Probes coupled:
Probes coupled:
Line 33: Line 33:
Name of probe set: lin-11
Name of probe set: lin-11
 +
Probes designed on Thu, 04 Mar 10 13:46:55 -0700
Probes designed on Thu, 04 Mar 10 13:46:55 -0700
 +
48 probes designed for target of length 1218
48 probes designed for target of length 1218
Line 39: Line 41:
ggtgatgatgaacgaagaag, lin-11_1, 1, 11, 45
ggtgatgatgaacgaagaag, lin-11_1, 1, 11, 45
 +
tcttctcctcttcttccagt, lin-11_2, 2, 33, 45
tcttctcctcttcttccagt, lin-11_2, 2, 33, 45
 +
tgaagatgatgagcaggagg, lin-11_3, 3, 55, 50
tgaagatgatgagcaggagg, lin-11_3, 3, 55, 50
 +
gacgtcttcaattgactgct, lin-11_4, 4, 77, 45
gacgtcttcaattgactgct, lin-11_4, 4, 77, 45
 +
tggcagatgaggtgacactg, lin-11_5, 5, 99, 55
tggcagatgaggtgacactg, lin-11_5, 5, 99, 55
 +
gcagagtcgagaagcagcaa, lin-11_6, 6, 121, 55
gcagagtcgagaagcagcaa, lin-11_6, 6, 121, 55
 +
ttgacgatggcatcatccac, lin-11_7, 7, 144, 50
ttgacgatggcatcatccac, lin-11_7, 7, 144, 50
 +
aatttcagagatgtgcggct, lin-11_8, 8, 170, 45
aatttcagagatgtgcggct, lin-11_8, 8, 170, 45
 +
tcaagaataggctgtgcaca, lin-11_9, 9, 211, 45
tcaagaataggctgtgcaca, lin-11_9, 9, 211, 45
 +
gagcacagtgaatacatatc, lin-11_10, 10, 233, 40
gagcacagtgaatacatatc, lin-11_10, 10, 233, 40
 +
caagactgatgccagcattt, lin-11_11, 11, 256, 45
caagactgatgccagcattt, lin-11_11, 11, 256, 45
 +
tcgacagtcacaacatcgaa, lin-11_12, 12, 278, 45
tcgacagtcacaacatcgaa, lin-11_12, 12, 278, 45
 +
aacaagtcattgacatgggc, lin-11_13, 13, 300, 45
aacaagtcattgacatgggc, lin-11_13, 13, 300, 45
 +
cagaataagaccatctctac, lin-11_14, 14, 323, 40
cagaataagaccatctctac, lin-11_14, 14, 323, 40
 +
cgttgactatatcgccttga, lin-11_15, 15, 358, 45
cgttgactatatcgccttga, lin-11_15, 15, 358, 45
 +
ttccaatttcccatcgcatc, lin-11_16, 16, 386, 45
ttccaatttcccatcgcatc, lin-11_16, 16, 386, 45
 +
ttatctcttgctcgtctcac, lin-11_17, 17, 418, 45
ttatctcttgctcgtctcac, lin-11_17, 17, 418, 45
 +
cggagcattgaaaacatcga, lin-11_18, 18, 450, 45
cggagcattgaaaacatcga, lin-11_18, 18, 450, 45
 +
ccagtgtccaataacctttg, lin-11_19, 19, 475, 45
ccagtgtccaataacctttg, lin-11_19, 19, 475, 45
 +
cttccatgatataaagctgg, lin-11_20, 20, 498, 40
cttccatgatataaagctgg, lin-11_20, 20, 498, 40
 +
cactttgacacacgaatcga, lin-11_21, 21, 522, 45
cactttgacacacgaatcga, lin-11_21, 21, 522, 45
 +
cgttgatgttttggttgctg, lin-11_22, 22, 551, 45
cgttgatgttttggttgctg, lin-11_22, 22, 551, 45
 +
acgggcctatgaatcgatgt, lin-11_23, 23, 574, 50
acgggcctatgaatcgatgt, lin-11_23, 23, 574, 50
 +
attgcattcggatccattgg, lin-11_24, 24, 596, 45
attgcattcggatccattgg, lin-11_24, 24, 596, 45
 +
acattatcctcctccacatc, lin-11_25, 25, 619, 45
acattatcctcctccacatc, lin-11_25, 25, 619, 45
 +
tccgacctcatcacaagcat, lin-11_26, 26, 641, 50
tccgacctcatcacaagcat, lin-11_26, 26, 641, 50
 +
aatcgccttctccatcatcg, lin-11_27, 27, 663, 50
aatcgccttctccatcatcg, lin-11_27, 27, 663, 50
 +
tcatctgaattgtccttccc, lin-11_28, 28, 685, 45
tcatctgaattgtccttccc, lin-11_28, 28, 685, 45
 +
acgccttttcgcagaattcg, lin-11_29, 29, 707, 50
acgccttttcgcagaattcg, lin-11_29, 29, 707, 50
 +
ctttaattgtcgttcgaggg, lin-11_30, 30, 729, 45
ctttaattgtcgttcgaggg, lin-11_30, 30, 729, 45
 +
gcgaacgcgttttttaaggt, lin-11_31, 31, 763, 45
gcgaacgcgttttttaaggt, lin-11_31, 31, 763, 45
 +
tcgagttggtttgggtgttg, lin-11_32, 32, 785, 50
tcgagttggtttgggtgttg, lin-11_32, 32, 785, 50
 +
cggcaagttgttcacggata, lin-11_33, 33, 807, 50
cggcaagttgttcacggata, lin-11_33, 33, 807, 50
 +
tctcatgttgagtcctgtct, lin-11_34, 34, 830, 45
tctcatgttgagtcctgtct, lin-11_34, 34, 830, 45
 +
ggttttgaaaccacacctga, lin-11_35, 35, 855, 45
ggttttgaaaccacacctga, lin-11_35, 35, 855, 45
 +
attcttcgttccttgcttcg, lin-11_36, 36, 877, 45
attcttcgttccttgcttcg, lin-11_36, 36, 877, 45
 +
cgatatcctccaaaacgaag, lin-11_37, 37, 904, 45
cgatatcctccaaaacgaag, lin-11_37, 37, 904, 45
 +
atctacaatatcgtcacggc, lin-11_38, 38, 941, 45
atctacaatatcgtcacggc, lin-11_38, 38, 941, 45
 +
attgttggtcattcgggaac, lin-11_39, 39, 963, 45
attgttggtcattcgggaac, lin-11_39, 39, 963, 45
 +
aacatttgatggtggaggtg, lin-11_40, 40, 992, 45
aacatttgatggtggaggtg, lin-11_40, 40, 992, 45
 +
gaagttgtgtatgggtcaca, lin-11_41, 41, 1021, 45
gaagttgtgtatgggtcaca, lin-11_41, 41, 1021, 45
 +
gccatttgaatggtttctgg, lin-11_42, 42, 1051, 45
gccatttgaatggtttctgg, lin-11_42, 42, 1051, 45
 +
cgttggaactgcaaattgtg, lin-11_43, 43, 1073, 45
cgttggaactgcaaattgtg, lin-11_43, 43, 1073, 45
 +
gctctggaaccatgttcata, lin-11_44, 44, 1098, 45
gctctggaaccatgttcata, lin-11_44, 44, 1098, 45
 +
gtcgctgattgttctgtgta, lin-11_45, 45, 1120, 45
gtcgctgattgttctgtgta, lin-11_45, 45, 1120, 45
 +
gtcttcattgaattctggcg, lin-11_46, 46, 1142, 45
gtcttcattgaattctggcg, lin-11_46, 46, 1142, 45
 +
cccaagtctgttgaatagat, lin-11_47, 47, 1174, 40
cccaagtctgttgaatagat, lin-11_47, 47, 1174, 40
 +
ccatgaaaccggagttggtt, lin-11_48, 48, 1196, 50
ccatgaaaccggagttggtt, lin-11_48, 48, 1196, 50

Current revision

Progress:

Probes designed: (03-04-2010 - Ni Ji)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>ZC247.3 (spliced coding sequence- 1218) ATGCATTCT TCTTCTTCGT TCATCATCAC CTCACTGGAA GAAGAGGAGA AGAAGCCTCC TGCTCATCAT CTTCATCAGC AGTCAATTGA AGACGTCGGC AGTGTCACCT CATCTGCCAC GTTGCTGCTT CTCGACTCTG CCACGTGGAT GATGCCATCG TCAACGACTC AGCCGCACAT CTCTGAAATT AGTGGAAATG AGTGTGCCGC GTGTGCACAG CCTATTCTTG ACAGATATGT ATTCACTGTG CTCGGAAAAT GCTGGCATCA GTCTTGTCTT CGATGTTGTG ACTGTCGAGC GCCCATGTCA ATGACTTGTT TTAGTAGAGA TGGTCTTATT CTGTGTAAAA CTGATTTTTC AAGGCGATAT AGTCAACGGT GTGCCGGATG CGATGGGAAA TTGGAAAAAG AGGATCTGGT GAGACGAGCA AGAGATAAAG TTTTTCATAT TCGATGTTTT CAATGCTCCG TTTGTCAAAG GTTATTGGAC ACTGGTGACC AGCTTTATAT CATGGAAGGC AATCGATTCG TGTGTCAAAG TGATTTTCAA ACAGCAACCA AAACATCAAC GCCCACATCG ATTCATAGGC CCGTATCCAA TGGATCCGAA TGCAATTCCG ATGTGGAGGA GGATAATGTG GATGCTTGTG ATGAGGTCGG ACTCGATGAT GGAGAAGGCG ATTGTGGGAA GGACAATTCA GATGACTCGA ATTCTGCGAA AAGGCGTGGC CCTCGAACGA CAATTAAAGC AAAACAACTT GAAACCTTAA AAAACGCGTT CGCCGCAACA CCCAAACCAA CTCGACATAT CCGTGAACAA CTTGCCGCCG AGACAGGACT CAACATGAGA GTCATTCAGG TGTGGTTTCA AAACCGCCGA AGCAAGGAAC GAAGAATGAA ACAACTTCGT TTTGGAGGAT ATCGTCAATC CCGAAGACCA CGCCGTGACG ATATTGTAGA TATGTTCCCG AATGACCAAC AATTCTACCC ACCACCTCCA CCATCAAATG TTCAATTCTT TTGTGACCCA TACACAACTT CTCCCAACAA TCCAGAAACC ATTCAAATGG CTCCACAATT TGCAGTTCCA ACGGAAAATA TGAACATGGT TCCAGAGCCA TACACAGAAC AATCAGCGAC CCCGCCAGAA TTCAATGAAG ACACATTTGC ATGTATCTAT TCAACAGACT TGGGAAAACC AACTCCGGTT TCATGGTAG



Name of probe set: lin-11

Probes designed on Thu, 04 Mar 10 13:46:55 -0700

48 probes designed for target of length 1218

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

ggtgatgatgaacgaagaag, lin-11_1, 1, 11, 45

tcttctcctcttcttccagt, lin-11_2, 2, 33, 45

tgaagatgatgagcaggagg, lin-11_3, 3, 55, 50

gacgtcttcaattgactgct, lin-11_4, 4, 77, 45

tggcagatgaggtgacactg, lin-11_5, 5, 99, 55

gcagagtcgagaagcagcaa, lin-11_6, 6, 121, 55

ttgacgatggcatcatccac, lin-11_7, 7, 144, 50

aatttcagagatgtgcggct, lin-11_8, 8, 170, 45

tcaagaataggctgtgcaca, lin-11_9, 9, 211, 45

gagcacagtgaatacatatc, lin-11_10, 10, 233, 40

caagactgatgccagcattt, lin-11_11, 11, 256, 45

tcgacagtcacaacatcgaa, lin-11_12, 12, 278, 45

aacaagtcattgacatgggc, lin-11_13, 13, 300, 45

cagaataagaccatctctac, lin-11_14, 14, 323, 40

cgttgactatatcgccttga, lin-11_15, 15, 358, 45

ttccaatttcccatcgcatc, lin-11_16, 16, 386, 45

ttatctcttgctcgtctcac, lin-11_17, 17, 418, 45

cggagcattgaaaacatcga, lin-11_18, 18, 450, 45

ccagtgtccaataacctttg, lin-11_19, 19, 475, 45

cttccatgatataaagctgg, lin-11_20, 20, 498, 40

cactttgacacacgaatcga, lin-11_21, 21, 522, 45

cgttgatgttttggttgctg, lin-11_22, 22, 551, 45

acgggcctatgaatcgatgt, lin-11_23, 23, 574, 50

attgcattcggatccattgg, lin-11_24, 24, 596, 45

acattatcctcctccacatc, lin-11_25, 25, 619, 45

tccgacctcatcacaagcat, lin-11_26, 26, 641, 50

aatcgccttctccatcatcg, lin-11_27, 27, 663, 50

tcatctgaattgtccttccc, lin-11_28, 28, 685, 45

acgccttttcgcagaattcg, lin-11_29, 29, 707, 50

ctttaattgtcgttcgaggg, lin-11_30, 30, 729, 45

gcgaacgcgttttttaaggt, lin-11_31, 31, 763, 45

tcgagttggtttgggtgttg, lin-11_32, 32, 785, 50

cggcaagttgttcacggata, lin-11_33, 33, 807, 50

tctcatgttgagtcctgtct, lin-11_34, 34, 830, 45

ggttttgaaaccacacctga, lin-11_35, 35, 855, 45

attcttcgttccttgcttcg, lin-11_36, 36, 877, 45

cgatatcctccaaaacgaag, lin-11_37, 37, 904, 45

atctacaatatcgtcacggc, lin-11_38, 38, 941, 45

attgttggtcattcgggaac, lin-11_39, 39, 963, 45

aacatttgatggtggaggtg, lin-11_40, 40, 992, 45

gaagttgtgtatgggtcaca, lin-11_41, 41, 1021, 45

gccatttgaatggtttctgg, lin-11_42, 42, 1051, 45

cgttggaactgcaaattgtg, lin-11_43, 43, 1073, 45

gctctggaaccatgttcata, lin-11_44, 44, 1098, 45

gtcgctgattgttctgtgta, lin-11_45, 45, 1120, 45

gtcttcattgaattctggcg, lin-11_46, 46, 1142, 45

cccaagtctgttgaatagat, lin-11_47, 47, 1174, 40

ccatgaaaccggagttggtt, lin-11_48, 48, 1196, 50

Personal tools