840:153g:Projects/project4
From OpenWetWare
Customize your entry pages
| |
Team Members
Project DescriptionINTRODUCTION In the course of this research experiment, the gene coding for the enzyme subtilisin will be engineered into E. coli. Subtilisin is a serine protease that was originally obtained from Bacillus subtilis. For the purposes of this experiment, subtilisin will be produced to serve as an antifungal compound. The gene coding for subtilisin, aprE, will be isolated from B. subtilis. Using a preliminary procedure outlined in this proposal, the aprE gene will be engineered into E. coli and will be regulated by a promotor. Once recombination has been confirmed, the cloned gene will be modified into BioBrick form and entered into the Registry of Parts.
The process of completing these goals will follow the general steps. The bacteria B. subtilis will be obtained for the source of the gene of interest. This will be obtained from Dr. Walter of UNI Biology. B. subtilis has been significantly researched and its complete genome is known, and was obtained from the NCBI website [1]. The gene coding for subtilisin, aprE, is located on the complementary sequence from 92689 – 93834. This sequence was analyzed to confirm that EcoR1, Xba1, Spe1, and Pst1 restriction sites are not present. Using this data, the following primers will be designed for the amplification of the gene via PCR. Forward Primer:
5’ [ATGAATTCGCGGCCGCTTCTAG]ATGAGAAGCAAAAAATTGTGG
Reverse Primer:
5’ [ATCTGCAGCGGCCGCTACTAGTA]TTATTGTGCAGCTGCTTGTAC
In addition to amplifying the aprE gene, these primers will create EcoR1, Xba1, Spe1, and Pst1 restriction sites around aprE, shown in brackets, which will allow it to be incorporated into a vector, and so that the resulting promoter-aprE sequence is BioBrick compatible. Once amplified, the aprE gene will be incorporated into a vector. The vector will be made from the plasmid pSB1A2 [2] or pSB2K3 [3] and the promotor BBa_R0080 [4] or BBa_I0500 [5]. These are available in the Registry of Parts and are BioBrick compatible. The plasmid is a high copy number plasmid containing ampicillin resistance. The promoter is arabinose inducible. It will therefore be possible to control the amount of subtilisin produced by a given plate of cells by varying the concentration of arabinose in the media. The ability to stop transcription of the aprE gene is useful, as a high concentration of the enzyme may be lethal to the E. coli. In order to incorporate the gene aprE into the vector, restriction enzymes will be used. The PCR product will be digested with Xba1 to cut before the aprE coding region. The plasmid will be digested with Spe1 to create a cut after the promoter. The restriction enzyme Pst1 will create sticky ends on both the PCR product and the plasmid. This will insert the aprE gene after the promoter, forming the vector. The vector will be introduced into the E. coli cells via transformation. Cells containing the vector will be obtained by selecting for ampicillin resistance. The surviving cells will be concluded to contain the vector by isolating the plasmid and analyzing it using gel electrophoresis.
The presence of the aprE gene will be determined through sequencing and testing for expression. Sequencing will confirm that the gene was transformed into the E. coli, but will not conclude its expression. To test if subtilisin is being produced, we will observe the effect of the engineered cells on a common mold. The mold to be used during the testing phase will be Aspergillus, which is also available from Dr. Walter. A typical test will be to plate mold cells onto a lawn of the transformed E. coli, and compare the growth of the mold with a control.
| |
|
Recent changes
| |



