840:153g:Projects/project4/2009/01/27

From OpenWetWare

Jump to: navigation, search
MoldBusters' Journal Main project page
Next entry

Tuesday 1/27

  • Primers were finalized and prepared for ordering. The following primers were designed:
    Forward Primer:
         5’ ATGAATTCGCGGCCGCTTCTAGATGAGAAGCAAAAAATTGTGG
    Reverse Primer:
         5’ ATCTGCAGCGGCCGCTACTAGTATTATTGTGCAGCTGCTTGTAC


  • Dr. Walter was contacted, and arrangements were made to obtain Bacillus and Aspergillus.
  • The location of the vector pSB1A2 + BBa_R0080 was found in the iGEM registry. For iGEM 2007: Well 21L on Parts Kit Plate 1. For Spring 2008: Well 11A on Source Plate 1001.
  • The vector pSB2K3 + BBa_I0500 was decided to be the backup.
Personal tools