BE.180:Assignment1/Promoter

From OpenWetWare

Jump to: navigation, search


taatacgactcactatagggaga

consensus T7 RNA polymerase promoter

Personal tools