BIOL368/F14:Chloe Jones Week 2

From OpenWetWare

Jump to: navigation, search

Contents

Electronic Lab Notebook

Week 2: Aipotu Genetics

Part I: Genetics-Crosses

Specific Tasks:

  1. How many different alleles are there? Which colors do they produce? It will be useful to use multiple-allele notation like this: CR = red; CG = green, etc.
  2. Which are dominant and which are recessive?
  3. How do the colors combine to produce an overall color? For this, it may help to make a genotype-phenotype table and then try to abstract rules from that. You should be sure that you have tried all the possible combinations of the alleles you found in part (a).
  4. Using the symbols you have developed, give the genotypes of the four starting organisms.
  5. Using this knowledge, construct a purple flower.
  6. Can you construct a pure-breeding purple flower with the starting set of organisms?
  7. Post your findings to your section’s Lab Data Blog.

Methods

In this lab, I had the genetics portion where I had to observe how flower color was inherited based on the alleles present in the original set of flowers. Using the Aipotu Genetics software I was given four original flowers with one being red, one being white, and two being green. I first started off with crossing all the organisms to them selves in order to observe if the flowers were heterozygous versus homozygous. Next, I crossed all the organisms to one another to see what colors they developed. My initial findings/hypothesis were that:

  1. White was homozygous, and recessive
  2. Green-1 was homozygous, and dominant
  3. Purple was heterozygous
  4. Red and Green-2 were not true breeding flowers (heterozygous)
  5. Some flowers had multiple genotypes


Results

1.) How many different alleles are there? Which colors do they produce? It will be useful to use multiple-allele notation like this: CR = red; CG = green, etc.

Phenotypes Genotypes Alleles
White CWC W CW
Yellow CYC Y
Orange CRCY
Red CRCW

CRCR,

Green CBCY

CGCG,

CG
Blue CBCB CB
Purple CRCB
Black CRCG

2.) Which are dominant and which are recessive?

  • CW is recessive
  • CR > CW
  • CB = CY

3.) Using the symbols you have developed, give the genotypes of the four starting organisms.

  • White= CWC W
  • Red= CRCW
  • Green-1= CGCG
  • Green-2= CBCY

4.) Using this knowledge, construct a purple flower.

  • Purples genotype is CRCB, thus we know that a red has to be crossed to a blue. However, in order to get a purple combination we have to cross a true breeding red to a true breeding blue.

1st Cross: Green-2 * Green-2 (CBCY * CBCY)

CR CB
CR CR CR CR CB
CB CR CB CB CB
  • Result: True Breeding Blue (CBCB
    • Save blue flower to list

2nd Cross: Green-2 * Red (CBCY * CRCW)

CR CW
CB CB CR CB CW
CY CR CY CW CY
  • Result: Purple, Blue, Orange, Yellow
    • Concentrating on purple (CBCR and orange (CYCR)

3rd Cross: Purple * Orange (CBCR * CYCR)

CB CR
CR CB CR CR CR
CY CB CY CY CR
  • Result: Purple, Red, Orange, Green
    • Concentrating on Red (CRCR)
      • Save true breeding red to list

4th Cross: True breeding red * true breeding blue (CRCR * CBCB)

CR CR
CB CB CR CB CR
CB CB CR CB CR
  • Result: All purple

Image:Purple.png

5.) Can you construct a pure-breeding purple flower with the starting set of organisms?

  • No, you cannot construct a pure breeding purple flower with the set of starting organisms because the red is heterozygous and there is no blue in the starting set.

Conclusion

  • My findings from the assignment concluded that a true breeding purple flower could not be developed from the starting strains provided. There were some colored flowers such as red and green that had two different genotypes which made it difficult at first to construct a purple flower.Also, the flower color white made it very hard to differentiate between a true breeding red because of its recessiveness. However, after finding the genotypes I was able to construct a purple flower using a true breeding blue and a true breeding red.

Part II: Genetics-Mutations

1.) Make a pure breeding strain of the color of your choice. Note the color here yellow.

  • Green-2 * Green-2 (CBCY * CBCY)
    • Get pure breeding yellow (CYC Y)
    • Mutate yellow → Orange

2.) Find out how the mutation has changed the Protein sequence.

  • Yellow: Met Ser Asn Arg His Ile ---- Leu---- Leu Val -------- Trp Cys --------- Arg Gln
  • Mutated Orange: Met Ser Asn Arg His Ile Phe Val Ser Val Val Ser Ala Val Val Lys Lys Lys Lys


3.) Find out how the mutation has changed the DNA Sequence.

  • Yellow:

5’CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT-3'

  • Mutated Orange:

5’CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT-3'

    • Difference at position 52

Personal tools