BME100 f2014:Group13 L5

From OpenWetWare

Jump to: navigation, search
BME 100 Fall 2014 Home
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Wiki Editing Help



Name: Katherine Salazar
Name: Katherine Salazar
Name: Michael Nguyen
Name: Michael Nguyen
Name: Jacob Irwin
Name: Jacob Irwin
Name: Esteban Cruz
Name: Esteban Cruz
Name: Dalal Almuhaidib
Name: Dalal Almuhaidib
Name: Nicholas Olivar
Name: Nicholas Olivar



Smart Phone Camera Settings

  • Type of Smartphone: Android S4
    • Flash: Inactivated
    • ISO setting:800
    • White Balance: Auto
    • Exposure: Highest Setting (+2.0)
    • Saturation: Highest Setting
    • Contrast:Lowest Setting


  1. Adjust the smartphone camera settings to the qualifications above, if possible.
  2. Place the phone in the cradle at a right angle from the slide.
  3. Adjust the height of the fluorimeter using the plastic trays so that the phone takes is viewing the drop from the side.
  4. Change the distance between the smartphone in its cradle and the first two rows of the slide so that it is as close as possible (but further the 4 cm away from the drop) without making the image blurry.
  5. Measure and record the distance from the smartphone cradle and the drop.

  • Distance between the smart phone cradle and drop = 4.7 cm

Solutions Used for Calibration

Initial Concentration of 2X Calf Thymus DNA solution (micrograms/mL) Volume of the 2X DNA solution (µL) Volume of the SYBR GREEN I Dye solution (µL) Final DNA concentration in SYBR Green I solution (µg/mL)
5 80 80 2.5
2 80 80 1
1 80 80 0.5
0.5 80 80 0.25
0.25 80 80 0.125
0 80 80 0

Placing Samples onto the Fluorimeter

  1. In the middle of the first two rows of the slide place an 80 µL drop of SYBR Green I using a pipettor. Make sure the drop is pinned and shaped like a ball.
  2. Next add 80 µL of one of the calf thymus (or water blank) solutions.
  3. Now align the drop by moving the slide so that the blue LED light is focused by the drop all the way to the other side of the drop where the middle of the black fiber optic fitting is.
  4. Place the light box over the fluorimeter and set a timer on the phone camera so that a picture can be taken after the flap of the light box is pulled down. The light box should eliminate most of the stray light but it is okay if there is a little bit of light coming in.
  5. Take three pictures of the drop while making sure the camera is focused on the drop each time.
  6. Be careful not to move the smartphone, as the distance must be kept constant. Carefully remove the light box.
  7. Remove the 160 µL drop from the surface with the pipettor and move the slide to the next position.
  8. Repeat all steps 1-7 for all the other concentrations of calf thymus DNA.

Data Analysis

Representative Images of Negative and Positive Samples
Positive Control:

Negative Control:

Image J Values for All Calibrator Samples


Calibration curve

PCR Results Summary

  • Our positive control PCR result was 5.71 μg/mL
  • Our negative control PCR result was 2.98 μg/mL

Observed results

  • Patient 67516 : The green parts of the droplet were not as large as that of those in the positive control, and were closer to that of the negative control. The values of the concentration had a large range, ranging from -2.7 μg/mL to 6.1 μg/mL. This is due to the fact that the camera on the phone changed resolutions without our knowledge, leading to certain pictures being in higher quality than others. This difference in quality skewed the ImageJ values among the different trials of the same patient, leading to the great difference in concentrations, despite the images looking qualitatively similar.
  • Patient 34174 : Similar to patient 67516, the green parts of the droplets were not as noticeable as those of the positive control. Also like patient 67516, the concentration values are not coherent, with two of them being around 1.6 μg/mL, and the third reaching 7.9 μg/mL. This can also be attributed to the differences in resolution due to the camera's automatic switching, leading to different ImageJ values, despite similar looks.


  • Patient 67516 : This patient is most likely to be negative, with this decision based mostly on the qualitative evidence. The calculated concentrations are not reliable, with one of the values for concentration being negative and another being much higher.
  • Patient 34174 : This patient is also most likely to be negative. The values for the concentration are better than that of patient 67516, with two of the values being relatively close and a lower number closer to the values of concentration in the negative control. Because the first two values are relatively close, the final value can be considered an anomaly. The qualitative evidence also backs this theory up, with the images of patient 34174 looking closer to that of the negative control rather than that of the positive control

SNP Information & Primer Design

Background: About the Disease SNP
A nucleotide is a sub-unit of nucleic acids such as DNA, or RNA. A polymorphism is a mutation of single pair. The species in which this variation can be found is Homo sapiens. The chromosome that the variation is listed on is 21:34370656. The clinical significance of this SNP is that it is Pathogenic. The gene associated with this SNP is KCNE2. The disease that is linked to this specific SNP is congenital long QT syndromes.

Primer Design and Testing

KCNE2 stands for the potassium voltage-gated channel, Isk-related family, member 2. Some KCNE2 functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. KCNE2 is in the the heart and muscle cells and gene mutations are associated with cardiac arrhythmia.

Alleles are alternate forms of the same gene. The associated allele for this disease is CTC.

numerical position of SNP: 34370656
non-disease forward primer: 5'- CATGGTGATGATTGGAATGT
200 bases right position: 34370856
non-disease reverse primer: 5'- CCCTTATCAGGGGGACATTT
disease forward primer: 5'- CATGGTGATGATTGGAATGC
disease reverse primer: 5'- CCCTTATCAGGGGGACATTT

Using the disease specific primers the results say "no matches" because the nucleotides of these two primers do not coincide with each other and are not matches for each other.

Personal tools