BME100 f2015:Group17 1030amL4

BME 100 Fall 2015	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Andrew Nelson: student Role(s) Taylor Underwood: student Role(s) Eric Slovak: student Role(s) Gus Laurin : student Role(s) Julianna Acero: student Role(s) Name: student Role(s) LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50 μL: the mix content contains Taq DNA polymerase, Magnesium dichloride, and dNTP's DNA/primer mix: 8 tubes are needed, each containing 50 μL. Each mix will have a different DNA template. All tubes should have the same forward and reverse primer A strip of empty PCR tubes Disposable pipette tips are needed. Use each pipette tip once. Never re-use disposable tips. Doing so can lead to cross contamination. A cup for discarded tips OpenPCR machine: shared by the two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G# + Positive control none G# - Negative control none G# 1-1 Patient 1, replicate 1 52130 G# 1-2 Patient 1, replicate 2 52130 G# 1-3 Patient 1, replicate 3 52130 G# 2-1 Patient 2, replicate 1 83165 G# 2-2 Patient 2, replicate 2 83165 G# 2-3 Patient 2, replicate 3 83165 DNA Sample Set-up Procedure Step 1: Extract DNA from a cell Step 2: Put the extracted DNA in a PCR tube Step 3: Add primer 1 to the PCR tube Step 4: Add primer 2 to the PCR tube Step 5: Add nucleotides to the PCR tube Step 6: Add Taq DNA polymerase to the PCR tube Step 7: Now that all of the components are in the PCR tube, place the tube in a DNA Thermal Cycler and start the machine. OpenPCR program Heated Lid: 100°C Initial Step: 95°C for 2 minutes. This step allows for the hydrogen bonds in DNA to break unraveling the DNA double helix allowing primers access to the strands. Number of Cycles:25. Repeat the following Denature and Extend Steps below. Denature: at 95°C for 30 seconds; Anneal:at 57°C for 30 seconds. Annealing allows for the primers to bind with the exposed DNA. Extend: at 72°C for 30 seconds. Extending allows for DNA polymerase to start adding complementary base pairs replicating a certain gene. Final Step: 72°C for 2 minutes Final Hold: 4°C Research and Development PCR - The Underlying Technology Function of a Component in a PCR Reaction Q1: Template DNA is used as a foundation to extract a desired section and replicate that section many times over. Two primers are used in PCR. One primer attaches to the beginning of the desired DNA site, and the other is attached to the end of the desired site when the DNA breaks up from its double helix structure. These primers help single out the sections we want to amplify. Taq Polymerase attaches to each primer site and adds complimentary base pairs to the single strand of DNA to make it double stranded. This replicates the DNA and, after a few cycles, will begin to isolate the desired section and replicate it. Deoxyribonucleotides are single units of DNA that the Taq polymerase forms to bond with a single strand of DNA in order for it to become a new strand of DNA of the replicated/desired gene. Q2 Initial Step: 95º C for 3 minutes The thermal cycler warms up to 95º C to prepare for denaturing Denature at 95º C for 30 seconds DNA (the double helix) separates to single strands for amplification Anneal at 57º C for 30 seconds Primers are added to the single DNA strands Extend at 72º C for 30 seconds Taq DNA polymerase is activated Final Step: 72º C for 3 minutes Complementary nucleotides are attached to single stranded DNA to create exact copies of the desired gene Final Hold: 4º C The temperature significantly decreases in order to prepare for the next cycle of replication Q3. Adenine (A) anneals to Thymine (T) Thymine (T) anneals to Adenine (A) Cytosine (C) anneals to Guanine (G) Guanine (G) anneals to Cytosine (C) Q4. In thermal cycling, base-pairing occurs during Extending at 72º C for 30 seconds (this is where the Taq DNA polymerase is added to the single strands) and then at the Final step at 72º C for 3 minutes, (this is where the Taq DNA polymerase goes down the single stranded DNA from 3’ to 5’ adding the appropriate matches in base pairs. AT, TA, GC, and CG). (Source:http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/B/BasePairing) SNP Information & Primer Design Background: About the Disease SNP A SNP (single-nucleotide polymorphism) is a variation in DNA, based upon one nucleotide. The nucleotides in DNA are A, T, C, and G. So for example, one person's DNA could read ATGCCA and another person's DNA could read ATGCGA. While these segments of DNA do differ by a C and a G, it does not mean that the amino acid sequence for a given protein is changed. Variations are allowed, and those variations are called alleles. In most SNP's there are only two alleles. Since an SNP is a variation in the DNA, the effect could be disastrous, or have no effect at all. It just depends on the location in the DNA and if the amino acid sequence is changed. Primer Design and Testing What is a nucleotide? – The basic structural unit of nucleic acids such as DNA What is polymorphism? – The presence of genetic variation within a population What species is the variation found in? – Homo Sapiens What chromosome is variation located on? – 16 What is listed as the clinical significance of this SNP? – Other What gene(s) is the SNP associated with? – MC1R (4157) What disease is linked to this SNP? – Renal cell carcinoma, Parkinson disease What does MC1R stand for? - melanocortin 1 receptor What is the function of MC1R? – G-protein coupled peptide receptor activity, hormone binding, melanocortin receptor activity What is an allele? – One of two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome The disease-associated allele contains what sequence? – TGG The numerical position of the SNP is – 1858 Non-disease forward primer (20nt) – CTGCGCTACCACAGCATCGT The numerical position exactly 200 bases to the right of the disease SNP: 89919936 Non-disease reverse primer (20nt) – GCGGCAGGGTCACGATGCTGT Disease forward primer (20nt) – CTGCGCTACCACAGCATCGA