DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes
have the same forward primer and reverse primer
A strip of empty PCR tubes
Disposable pipette tips: only use each only once. Never reuse disposable pipette tips . If you
do, the samples will become cross-contaminated
Cup for discarded tips
Micropipettor
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G3 +
Positive control
none
G3 -
Negative control
none
G3 1-1
Patient 1, replicate 1
73066
G3 1-2
Patient 1, replicate 2
73066
G3 1-3
Patient 1, replicate 3
73066
G3 2-1
Patient 2, replicate 1
57254
G3 2-2
Patient 2, replicate 2
57254
G3 2-3
Patient 2, replicate 3
57254
DNA Sample Set-up Procedure
Step 1: Extract DNA from Patient 1 and Patient 2.
Step 2: Take the DNA from the patients and place them in separate PCR tubes.
Step 3: Add the first primer into both of the PCR tubes.
Step 4: Add the second primer into both of the PCR tubes.
Step 5: Add the nucleotides into both the PCR tubes.
Step 6: Add the DNA polymerase into both the PCR tubes
Step 7: Place the PCR tubes into the thermal cycler
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes- This step will heat up the solution to almost boiling.
NUMBER OF CYCLES: 25
Denature at 95°C for 30 seconds- This step will separate the double helix DNA strand into two single strands.
Anneal at 57°C for 30 seconds- In this step, primers will attach to specific DNA sequences to prevent the two strands from reattaching.
Extend at 72°C for 30 seconds-DNA polymerases are activated and attach to primers.
FINAL STEP: 72°C for 2 minutes-DNA polymerases begin attaching complimentary nucleotides to the strands to complete new replicated DNA strands.
FINAL HOLD: 4°C- This step prevents the DNA from further replicating and holds the new strands together for storing.
Research and Development
PCR - The Underlying Technology
The Component Functions of a PCR Reaction
The function of template DNA in the PCR reaction is to be the sample DNA that contains the target sequence. DNA polymerase uses template DNA to amplify the target DNA. The primers attach to the sights of the DNA strand to copy or replicate. Since they rarely get the sequence wrong, primers are very accurate tools to identify a specific DNA sequence. Taq Polymerase is responsible for reading the DNA code and then attaching nucleotides to create new DNA strands. Nucleotides are the genetic building blocks (A, C, G, T). They are added to the PCR tube to allow the creation of billions of new DNA copies during the PCR reaction.
The Reaction of the Components During Each Step of Thermal Cycling
At the initial step of thermal cycling at 95 degrees Celsius, the thermal cycler heats up the solution to almost boiling point. After the three minutes, the next thirty seconds at the same temperature, the DNA denatures or rather, the DNA separates from double strand to single strands. Lowering the temperature to 57 degrees Celsius, the annealing step involves single DNA stranded molecules beginning to pair up. In the tube, there is a greater number of primer sequences than DNA. The primers attach onto their target before the strands are able to rejoin. Then, extending the DNA by raising the temperature to seventy-two degrees celsius for thirty seconds, DNA polymerases are activated and attach to the specific sequences of DNA where the primers are located. In the final step at seventy-two degrees celsius for thirty seconds, the DNA polymerases begin adding complementary nucleotides until it reaches the end of the strand. Once the new replication DNA strands are created, the temperature is decreased to four degrees celsius to store and hold the DNA, preventing it from heating up again. This final process allows the newly replicated DNA stay within the double-strands and prevents it from further replication.
Nucleotides and Their Complimentary Pairs
Nucleotides during base-pairing always match up with a specific corresponding nucleotide. Adenine (A) will always pair up with Thymine (T), as Thymine will always match up with Adenine. Likewise, Cytosine (C) will always pair up with the nucleotide Guanine (G), while Guanine will always pair up with Cytosine.
When Base-Pairing Occurs
Base-pairing occurs during the both of the steps when the temperature is at 72 degrees Celsius and the DNA polymerases are activated. Once the DNA polymerases are activated, their job is to attach to the sight of the primers and begin matching up complementary nucleotides until they fall off the end of the strand and complete a new replication strand of DNA.
SNP Information & Primer Design
Background: About the Disease SNP
rs35530544, found in Homo sapiens, is located in chromosome four. Its pathogenic and mutations in this gene cause long QT syndrome 4 and cardiac arrhythmia syndrome. ANK2 stands for ankyrin 2 and Ankyrins are crucial in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. The disease-associated allele is ATC and the non-disease associated allele is CTC. The position of the SNP is 114288907.
Primer Design and Testing
According to our online simulation, we received the following results of the primers:
Non-disease forward primer: GGACAGCTCAGCAACAGCAC
Non-disease reverse primer: TAAAAAGTATTTAAAAACTA
Disease forward primer: GGACAGCTCAGCAACAGCAA
Disease reverse primer: TAAAAAGTATTTAAAAACTA
By using the UCSC In-Silico PCR website, we were able to confirm our results. We know that both our non-disease forward primer and non-disease reverse primer are correct because the results indicated that they were located on chromosome four like indicated. We know that our disease reverse and forward primers are correct as well because there were no results found in the database, indicating that the disease is a foreign agent to the human body and cannot be identified as part of the human genome. These results are depicted by the following images:
BME 100 Fall 2016
