DNA/ primer mix , 8 tubes, 50 mL each:Each mix contains a different templarte DNA. All tubes have the same forward primer and reverse primer
A strip of of empty PCR tubes
Disposable pipette tips: only use each once. Never reuse dipsosable ipette tips. If you do, the samples will become cross-contaminated.
Cup for discarded tips
Micropipettor
OPenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G7 +
Positive control
none
G7 -
Negative control
none
G7 1-1
Patient 1, replicate 1
57027
G7 1-2
Patient 1, replicate 2
57027
G7 1-3
Patient 1, replicate 3
57027
G7 2-1
Patient 2, replicate 1
97392
G7 2-2
Patient 2, replicate 2
97392
G7 2-3
Patient 2, replicate 3
97392
DNA Sample Set-up Procedure
Step 1: drag the extracted DNA to the PCR tube
Step 2: Add primer 1 to the PCR tube
Step 3: Add Primer 2 to the PCR tube
Step 4: Add nucleotides to the PCR tube
Step 5: Add DNA polymerase to the PCR tube
Step 6: Place the PCR tube in the DNA Thermalcycler
Step 7: Start the Thermacycler
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds
Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
Q1. What is the function of each component of a PCR reaction?
Template DNA:
The DNA template contains the target sequence of DNA. It is used as the base strand that all further DNA is synthesized from.
Primers:
The primers are short pieces of DNA that are complementary to the target DNA sequence or the template DNA. They allow the polymerase to synthesize new DNA strands.
Taq Polymerase:
This polymerase synthesizes new DNA strands from the primers that are complementary to the DNA strand it is being synthesized from.
Deoxyribonucleotides(dNTP’s):
These are nucleotides which are the building blocks of the DNA strands.
Q2. What happens to the components (listed above) during each step of thermal cycling?
INITIAL STEP: 95°C for 3 minutes:
The double stranded DNA unfurls and becomes less stable in preparation for its denaturing.
Denature at 95°C for 30 seconds:
The double stranded DNA splits into two seperate strands which new DNA can be synthesized form.
Anneal at 57°C for 30 seconds:
The primers force their way to bind to their base pairs in split DNA strands.
Extend at 72°C for 30 seconds:
This activates DNA polymerase and causes it to bind to the primers attached to DNA single strands.
FINAL STEP: 72°C for 3 minutes:
The DNA polymerase creates nucleotides along the DNA creating more base pairings, creating a new double stranded DNA.
FINAL HOLD: 4°C:
At this temperature the reaction can be stored for a short time.
Q3. DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G.
Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to
each base listed below?
Adenine (A):
Thymine (T)
Thymine (T):
Adenine (A)
Cytosine (C):
Guanine (G)
Guanine (G):
Cytosine (C)
Q4. During which two steps of thermal cycling does base-pairing occur? Explain your answers. When it anneals at 57 degrees celsius the primers find their base-pairs on DNA single strands and bind to them. Then at the final step of 72 degrees celsius the DNA polymerase creates nucleotides which are base-pairs of the the DNA strand.
SNP Information & Primer Design
Background: About the Disease SNP
What is a nucleotide?
a compound consisting of a nucleotide linked to a phosphate group. Nucleotides form the basic structural unit of nucleic acid such as DNA
What is a polymorphism?
a common variation in the sequence of DNA among individuals. Genetic variations occurring in more than 1% of the population would be considered useful polymorphism for genetic linkage analysis.
What species is this variation found in? (latin name)
homosapiens
What chromosome is the variation located on?
4
What is listed as the Clinical significance of this SNP?
pathogenic allele
What condition is linked to this SNP?
a cardiac arrhythmia syndrome caused by loss of ankyrin-B function
What does ANK2 stand for?
ankyrin 2, neuronal
What is the function of ANK2? To find out, click the ANK2 link. Under Table of Contents (right side) click Gene ontology. Write the first three unique terms you see.
one of the two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome
The disease-associated allele contains what codon?
CTC→ATC
The numerical position of the SNP is:
113367751
Non-disease forward primer (20 nt):
5' GGACAGCTCAGCAACAGCAC 3'
The numerical position exactly 200 bases to the right of the disease SNP is:
113367951
Non-disease reverse primer (20 nt):
5' TAAAAAGTATTTAAAAACTA 3'
Disease forward primer (20 nt):
5' GGACAGCTCAGCAACAGCAG 3'
Disease reverse primer (20 nt):
5' TAAAAAGTATTTAAAAACTA 3'
Primer Design and Testing
Based on the results of the primer test it can be concluded that the non disease primer indicated a 220bp sequence on the 4 chromosome. The disease primer resulted in no match.
BME 100 Fall 2016
