BME100 s2014:T Group5 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
goPCR Name: Keerthana Murali Name: Stephanie DiIullo Name: Melissa Thomas Name: Supreet Kaur LAB 6 WRITE-UP Computer-Aided Design TinkerCAD We used the TinkerCAD tool in lab on April 17th to create a design of the changes we would make to the PCR machine. We went to Thingiverse and imported a file of the main heating block of the Open PCR machine. When it was imported into TinkerCAD, we were then able to make adjustments to the main heating block. We also downloaded the main walls of the Open PCR machine and added a LCD screen to the front outside panel. Our Design Top View of New Heating Plate Side View of New Heating Plate Side View of PCR with New LCD Screen Front View of PCR with New LCD Screen We chose to make two changes to the Open PCR machine. We first added a row of larger holes to the heating block. We also added black markers to designate the larger holes. This addition was made so that the PCR machine could accommodate larger tubes if needed. Secondly, we added a LCD screen to the front side of the Open PCR machine. With this screen, the researcher/scientist will be able to program the cycles directly on the PCR instead of having to connect it to a computer. This will allow for the PCR to be used in new locations. Feature 1: Disease SNP-Specific Primers The nucleotide is commonly known as the monomer of DNA. Nucleotide is a compound consisting of a nitrogenous base, phosphate group and a sugar. Polymorphism is the occurrence of two distinct phenotypes found in a population, upon which natural selection occurs. An allele is one of numerous forms of a gene. An allele is also located at a specific position on a specific chromosome. The SNP rs23702, is an allele found in humans (homo sapiens). The exact location of it is 149721690. It is associated with the SUM04 And TAB2 genes. The SUM04 is also called the small ubiquitin like modifier 4 gene and functions as a missence and config reference. The SNP is also associated with Type 1 and Type 2 diabetes. The disease containing allele is ATG. Primer design Disease SNP-specific Forward Primer: AACCACGGGGATTGTCAGTG Reverse Primer: TTGGTGCCCCTAACAGTCAC How the primers work: After the DNA is denatured and the temperature is lowered, the disease specific forward primer will bind to the complementary disease containing template at the 3' end. The reverse primer will bind to the complementary strand at the 3' end. The primers will then be used to replicate the specific section of the DNA strands. If the SNP containing template is not present the reaction will not occur as the primer will not be able to bind to the template completely. Feature 2: Consumables Kit Along with the PCR, a consumables kit would come with the product. The main goal of the consumables kit is to present all consumables in an organized fashion. There will be 16 empty color-coded PCR tubes. The color coding will help the researcher/scientist distinguish different groups of samples used in the experiment. There will also be pre-labeled tubes with the primers. The tubes containing the SYBR green will be included in the set in black tubes. This will allow no light to reach it since the SYBR green dye is photosensitive. All tubes will also have a white surface for labeling that will hold marker better. The micro pipetter would be included in the kit but packaged in another box within the packaging so it does not break. The kit will also include a pamphlet with the functions of all the materials and PCR tips and tricks. The kit will contain all the materials used in the lab and each material will be labeled and packaged separately to ensure there will not be cross-contamination. Inventory of Consumables Kit: 16 Colored coded/white blank label PCR tubes 2 Pre-labeled primer tubes 2 SYBR green in black tubes 1 Micro-Pipette 1 box of micro-pipette tips 1 Pamphlet with directions 16 Glass slides Feature 3: Hardware - PCR Machine & Fluorimeter PCR MACHINE: The PCR Machine or the Thermal Cycler is used to amplify DNA through the polymerase chain reaction. The machine goes through about 30-40 cycles with three steps that include denaturation, annealing, and extention. The redesigned PCR machine will have bigger holes for the samples to amplify a higher amount of DNA during the process. Also, there will be a LCD screen added to the side of the machine to easily enter the information from the cycles. This would make the PCR process easier since it can be programmed right on the machine instead of having to plug the PCR into a computer. FLUORIMETER: A fluorimeter will be included in the product to allow the researcher/scientist the ability to examine the results of the PCR reaction. After the PCR reaction is completed, the researcher/scientist will create a single drop sample by placing a sample of SYBR Green dye and the PCR product. A blue light is then shined across the drop sample and a picture is taken. After analysis of the green channel of the image in ImageJ and comparison against the controls, the scientist/researcher will be able to predict whether the sample is positive or negative for the allele. We did not make any changes to the fluorimeter system. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach The Bayesian statistics results show that the OpenPCR is not reliable at predicting the particular diabetes we looked at in this experiment. The probability that a patient will develop the disease and get a positive test result after using the PCR and fluorimeter was small and not close to 1. The probability that a patient will not develop a disease and get a negative result was higher than the positive correlation but was still not close to the optimal result of 1. This would not be an optimal method of predicting the diabetes we looked at in this experiment.