BME100 s2015:Group15 12pmL5

From OpenWetWare
Jump to navigationJump to search
BME 100 Spring 2015 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR TEAM

Name: Jasilynn Cox
Name: Kelsie Hermanson
Name: Alexzandra Rico
Name: Tyler McCluskey
Name: Matt Birkholz


LAB 5 WRITE-UP

Procedure

Smart Phone Camera Settings

  • Type of Smartphone: iPhone 5
    • Flash: Off
    • ISO setting: 800
    • White Balance: Auto
    • Exposure: Auto
    • Saturation: Auto
    • Contrast: Auto


Calibration

The camera was set up in front of the fluorimeter by placing it within a cradle. The cradle was placed 6 cm from the droplet on the plate. Then a box was placed over the camera and drop.

  • Distance between the smart phone cradle and drop = 6 cm


Solutions Used for Calibration

Initial Concentration of 2X Calf Thymus DNA Solution (mg/mL) Volume of the 2X DNA Solution (microliters) Volume of the SYBR Green I Dye Soultion (microliters) Final DNA Concentration in SYBR Green I Solution (miroliters)
0 80 80 0
0.25 80 80 0.125
0.5 80 80 0.25
1 80 80 0.5
2 80 80 1
5 80 80 2.5
-



Placing Samples onto the Fluorimeter

  1. Step 1, 80 micro-liters of SYBR GREEN I was pipette and placed on the first row in the first column on the Superhydrophobic surface. 80 micro-liters of the Calf Thymus DNA concentration 5 solution was placed in the exact same spot; first row first column. Superhydrophobic surface was moved so the drop of solution was in front of the blue LED light on the Fluorimeter. Camera was focused and three pictures were saved. Pipette tip was discarded and replaced.
  2. Step 2, 80 micro-liters of SYBR GREEN I was pipette and placed on the first row in the second column on the Superhydrophobic surface. 80 micro-liters of the Calf Thymus DNA concentration 2 solution was placed in the exact same spot; first row second column. The drop was aligned in front of the blue LED light and three pictures were saved. Pipette tip was discarded and replaced.
  3. Step 3, The previous steps were repeated for the following solutions in the following location...

80 micro-liters of SYBR GREEN I were pipette and placed on the first row in the third column on the Superhydrophobic surface. 80 micro-liters of the Calf Thymus DNA concentration 1 solution was placed in the exact same spot; first row third column. 80 micro-liters of SYBR GREEN I were pipette and placed on the first row in the fourth column on the Superhydrophobic surface. 80 micro-liters of the Calf Thymus DNA concentration 0.5 solution was placed in the exact same spot; first row fourth column. 80 micro-liters of SYBR GREEN I were pipette and placed on the second row in the first column on the Superhydrophobic surface. 80 micro-liters of the Calf Thymus DNA concentration 0.25 solution was placed in the exact same spot; second row in the first column. 80 micro-liters of SYBR GREEN I were pipette and placed on the second row in the second column on the Superhydrophobic surface. 80 micro-liters of the Calf Thymus DNA concentration 0 solution was placed in the exact same spot; second row in the second column.

  1. Step 4, The patient solutions were placed on the Superhydrophobic surface. 80 micro-liters of DILUTED PCR Product patient number G15 1-1 was pipette and placed on the second row in the third column on the Superhydrophobic surface. 80 micro-liters of SYBR GREEN I was placed in the exact same spot; second row in the third column. Superhydrophobic surface was moved so the drop of solution was in front of the blue LED light on the Fluorimeter. Camera was focused and three pictures were saved. Pipette tip was discarded and replaced.
  2. Step 5, The previous step was completed for the patient solutions in the following locations..

80 micro-liters of SYBR GREEN I was pipette and placed on the second row in the fourth column on the Superhydrophobic surface. 80 micro-liters of DILUTED PCR Product patient number G15 1-2 was placed in the exact same spot; third row in the first column. 80 micro-liters of SYBR GREEN I was pipette and placed on the third row in the first column on the Superhydrophobic surface. 80 micro-liters of DILUTED PCR Product patient number G15 1-3 was placed in the exact same spot; third row in the first column. 80 micro-liters of SYBR GREEN I was pipette and placed on the third row in the second column on the Superhydrophobic surface. 80 micro-liters of DILUTED PCR Product patient number G15 2-1 was placed in the exact same spot; third row in the second column. 80 micro-liters of SYBR GREEN I was pipette and placed on the third row in the fourth column on the Superhydrophobic surface. 80 micro-liters of DILUTED PCR Product patient number G15 2-2 was placed in the exact same spot; third row in the fourth column. 80 micro-liters of SYBR GREEN I was pipette and placed on the third row in the fourth column on the Superhydrophobic surface. 80 micro-liters of DILUTED PCR Product patient number G15 2-3 was placed in the exact same spot; third row in the fourth column.

  1. Step 6, On a new Superhydrophobic surface, 80 micro-liters of the controlled solution labeled positive was placed on first row first column of the slide. Superhydrophobic surface was moved so the drop of solution was in front of the blue LED light on the Fluorimeter. Camera was focused and three pictures were saved. Then, 80 micro-liters of the controlled solution labeled negative was placed on the first row second column of the slide. Superhydrophobic surface was moved so the drop of solution was in front of the blue LED light on the Fluorimeter. Camera was focused and three pictures were saved. Pipette tip was discarded and replaced.
  2. Step 7, slides were discarded, Fluorimeter was put away, work station was cleaned.


Data Analysis

Representative Images of Negative and Positive Samples


Negative Control:

Positive Control:


Image J Values for All Calibrator Samples

Final DNA Concentration of SYBR Green Solution 1 (μg/mL) Area Mean Pixel Value Rawintden of the Drop Rawintden of the Background Rawintden of Drop-Background
2.5 1374 170.5 472573 8914 463659
2.5 1535 164.311 4753167 10166 4743001
2.5 1451 166.101 468810 9706 459104
1 1668 171.558 286158 9149 277009
1 1806 167.444 302403 11372 291031
1 1714 168.285 288441 10001 278440
0.5 1195 133.204 174882 7479 167403
0.5 1356 127.15 170501 8731 161770
0.5 1272 128.805 171952 8271 163681
0.25 1336 116.305 154375 9830 144545
0.25 1486 120.649 150508 9627 140881
0.25 1486 121.182 152861 9878 142983
0.125 1356 87.227 118280 11693 106587
0.125 1356 87.388 118498 11373 107125
0.125 1356 89.757 121711 11712 109999
0 1440 63.26 91094 9949 81145
0 1440 61.522 88591 10257 78334
0 1440 58.929 84858 10139 74719
Final DNA Concentration of SYBR Green Solution 1 (μg/mL) Rawintden of Drop-Background 1 Rawintden of Drop-Background 2 Rawintden of Drop-Background 3 Mean Standard Deviation
2.5 463659 465151 459104 462638 3150.140156
1 277009 291031 278440 282160 7715.757967
0.5 174882 170501 171952 172445 2231.720637
0.25 167403 161770 163681 164285 2864.608583
0.125 144545 140881 142983 142803 1838.620135
0 81145 78334 74719 78066 3221.371913


Calibration curve


y = 144538x + 111674


PCR Results Summary

PCR Product Tube Label Area Mean Pixel Value RAWINTDEN of the Drop RAWINTDEN of the Background RAWINTDEN of the Drop - Background
G15 + Picture 1 1952 183.093 357398 16902 340496
G15 + Picture 2 1952 182.815 356854 16910 339944
G15 + Picture 3 1952 184.06 359286 18573 340713
G15 - Picture 1 1952 103.169 201385 18190 183195
G15 - Picture 2 1952 100.181 195554 18667 176887
G15 - Picture 3 1952 102.21 199514 19908 179606
G15 1-1 Picture 1 1952 183.698 358579 19648 338931
G15 1-1 Picture 2 1952 184.044 359254 19118 340136
G15 1-1 Picture 3 1952 184.44 360027 19380 340647
G15 1-2 Picture 1 1356 129.691 175861 13970 161891
G15 1-2 Picture 2 1356 127.962 173516 13317 160199
G15 1-2 Picture 3 1356 133.532 181069 13344 167725
G15 1-3 Picture 1 1356 134.926 182959 9013 173946
G15 1-3 Picture 2 1356 131.734 178631 9083 169548
G15 1-3 Picture 3 1356 136.993 185763 9013 176750
G15 2-1 Picture 1 1008 205.278 206920 7732 199188
G15 2-1 Picture 2 1008 201.812 203427 7632 195795
G15 2-1 Picture 3 1008 202.999 204623 7482 197141
G15 2-2 Picture 1 1592 157.801 251219 10976 240243
G15 2-2 Picture 2 1592 163.599 260450 10881 249569
G15 2-2 Picture 3 1592 166.413 263265 11931 251334
G15 2-3 Picture 1 1504 190.01 285775 14647 271128
G15 2-3 Picture 2 1504 190.885 287091 16473 270618
G15 2-3 Picture 3 1504 186.031 279790 14347 265443
PCR Product Tube Label MEAN RAWINTDEN DROP - BACKGROUND PCR Product Concentration (µg /mL) Initial PCR Product Concentration (µg /mL)
G15 + 340384.3 1.582 3.164
G15 - 179896 0.472 0.944
G15 1-1 339904.7 1.579 3.158
G15 1-2 163271.7 0.357 0.714
G15 1-3 173414.7 0.427 0.854
G15 2-1 197374.3 0.593 1.186
G15 2-2 247048.7 0.9366 1.8732
G15 2-3 269063 1.089 2.178
  • Our positive control PCR result was 3.164 μg/mL
  • Our negative control PCR result was 0.944 μg/mL

Observed results

  • Patient 50018 : The images appeared to have less green phosphorescence as the trials went on. The first trial was very bright in the color and the second and third appeared less so, nearly colorless. The first trial had a Initial PCR Product Concentration of 3.158 μg/mL, the second 0.714 μg/mL, and the third 0.854 μg/mL.
  • Patient 69797 : All three trials were green and glowing, the first was more clear than the other two. Numerically, the first trial had 1.186 μg/mL, the second trial 1.8732 μg/mL, and the third trial 2.178 μg/mL.

Conclusions

  • Patient 50018 : It may be inferred that this patient is negative for the disease as two of the three trials received concentrations under that of the concentration recorded for the negative control.
  • Patient 69797 : It may be inferred that this patient is positive for the disease as all three trials received concentrations over that of the concentration recorded for the negative control.




SNP Information & Primer Design

Background: About the Disease SNP What is a Nucleotide? A nucleotide is the structural component of DNA and RNA. They consist of four base pairs (Adenine, Thymine, Guanine, and Cytosine), a sugar molecule, and a phosphoric acid.

What is a polymorphism ? A Polymorphism, is a naturally occurring variation in a DNA sequence, gene, or chromosomes. They do not have any adverse effects on and individual occur fairly often in the general population. It involves variants of a DNA sequence, more commonly at a single base pair. Polymorphisms that occur in long stretches of DNA are known as single nucleotide polymorphism, or SNPs.


What species is this variation found in? (latin name) Homo sapiens.

What chromosome is the variation located on? The variation is located on the chromosome 8: base pairs 19956018 position 21948.

What is listed as the clinical significance of this SNP? The clinical significance of the SNP is it is “Pathogenic allele”.

Which gene(s) is this SNP associated with ? This is associated with the LPL gene. What disease is linked to this SNP? This is SNP is linked with Metabolic syndrome. What does LPL stand for ? LPL also known as lipoprotein lipase.

What is the function of LPL? This gene codes for the production of the LPL enzyme which is responsible for breaking down fat in the form of triglycerides. TH enzyme is found on the surface of cells that line the capillaries withing muscles on fatty tissue. This enzyme breaks triglycerides which carry fat to the bloodstream form different organs; when LPL breaks down these triglycerides the fat molecules are used as energy or stored in fatty tissue for later use.

What is an allele? An allele is two or more versions of a gene. An individual inherits two alleles for each gene, one from each parent. if the alleles are the same they are homozygous and if they are different they are heterozygous. Allele is a term used to describe the variation among genes and non-coding DNA sequences.

The disease associated allele contains the three bases A, G, T while the non-disease allele has base pairs A, A, T.


Primer Design and Testing

  1. The numerical position of the SNP is 19956018
  2. Non-disease forward primer (20 nt): aatctgggctatgagatcaa
  3. The numerical position exactly 200 bases to the right of the disease SNP is: 19956218
  4. Non-disease reverse primer (20 nt): gaaacaccagggctcagggt
  5. Disease forward primer (20 nt): aatctgggctatgagatcag
  6. Disease reverse primer (20 nt): gaaacaccagggctcagggt