Turn on the Fluorimeter and place the glass slide inside of it with the smooth side down
Place the smart phone on the cradle at a distance greater than 4 cm from the Fluorimeter and set the camera for 3 seconds.Also adjust height of the Fluorimeter in order to make sure it is aligned with the camera.
Distance between the smart phone cradle and drop = 8 CM
Solutions Used for Calibration
Calibration with 5 units of DNA per microliter
Calibration with 2 units of DNA per microliter
Calibration with 1 units of DNA per microliter
Calibration with 0.5 units of DNA per microliter
Calibration with 0.25 units of DNA per microliter
Calibration with Water
Placing Samples onto the Fluorimeter
Turn on the Fluorimeter and place the glass slide inside of it with the smooth side down
Place the smart phone on the cradle at a distance greater than 4 cm from the Fluorimeter and set the camera for 3 seconds.Also adjust height of the Fluorimeter in order to make sure it is aligned with the camera.
Pipette 80 µL of SYBR Green I solution onto the glass slide, and place the drop between two of the circles vertically.
[ Place 80 µL of the sample calibration solution on top of the drop from step 3, adjust the slide so that the blue light is going through the middle of the now larger drop.
Make sure the camera of the phone is focused on the drop, if not adjust it, it cannot be closer than 4cm from the drop
Cover the system with the black box, but make sure the camera is focused
Press the camera button to take the picture making sure that there is enough time for the flap to be lowered
Remove the 160 µL from the slide and place it in the waste container
Move the slide to the next position and repeat these steps
Data Analysis
Representative Images of Negative and Positive Samples
Positive Control
Negative Control
Image J Values for All Calibrator Samples
Calibration curve
Note: Our camera was not sensitive enough to capture the high concentrations of SYBR green. Here is another graph with a more accurate trend line.
More Accurate Trend Line: y = 1348361.943 x + 305395.4
PCR Results Summary
Our positive control PCR result was 0.5989 μg/mL
Our negative control PCR result was 1.076 μg/mL (This is perplexing, and probably inaccurate, because the positive control is green in the picture above and the negative control is not green.)
Observed results
Patient 11553 : The pictures from this patient appeared a little green while the μg/mL value is close to 0.5 (the average sample value totaled 0.463 μg/mL).
Patient 91905: The pictures from this patient did not appear green and the μg/mL value is marginally close to 0 (the average sample value totaled 0.0619 μg/mL).
Conclusions
Patient 11553 tested positive: The y-values from the samples are approximately 1,000,000 while the value of the positive control is 1,100,000.
Patient 91905 tested negative: (Assuming the value for μg/mL of the negative control is incorrect and should be closer to 0) the y-values of this patient were significantly lower and did not contain that much green.
SNP Information & Primer Design
Background: About the Disease SNP
The SNP disease is found in Homo sapiens and is linked to the chromosome 8:19956018. The clinical significance of the SNP disease is that pathogenic mutations are possible and can damage the Homo sapien with this mutation. SNP is associated with the LPL (lipoprotein lipase) gene and linked to metabolic syndrome and coronary heart disease. A few of the many functions of the Lipoprotein Lipase gene are Apolipoprotein Binding, Heparin Binding, and Lipoprotein Lipase Activity. An allele is one of two or more alternative forms of a gene that arise by mutation and are found at the same place of the chromosome. A polymorphism occurs when two or more clearly different phenotypes exists in the same population of a species occurs when two or more clearly different phenotypes exists in the same population of a species.A polymorphism can result in an allele. The polymorphism which can result in this allele is AGT. The numerical position of SNP is 19956018. The normal non-diseased chromosome of an individual not containing this diseased allele is 5’ - AATCTGGGCTATGAGATCAA. The mutation of an A to a G results in a diseased gene that is linked with coronary heart disease.
Primer Design and Testing
Once tested the diseased primer was found to have the mutation, AGT, within the genetic code. There were no results for the nondiseased primers.
The numerical position of the SNP is: 19956018
Non-disease forward primer (20 nt): 5’- AATCTGGGCTATGAGATCAA
Numerical position 200 bases to the right of the disease SNP: 19956218
BME 100 Spring 2015
