BME100 s2015:Group4 12pmL5

From OpenWetWare

Jump to: navigation, search
BME 100 Spring 2015 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png


Contents

OUR TEAM

Name: Sydney Wallace
Name: Sydney Wallace
Name: Nima Sadeghi
Name: Nima Sadeghi
Name: Fatimah Alhabib
Name: Fatimah Alhabib
Name: Jonathan Moroneso
Name: Jonathan Moroneso


LAB 5 WRITE-UP

Procedure

Smart Phone Camera Settings

  • Type of Smartphone: iPhone 5s
    • Flash: Off
    • ISO setting: N/A
    • White Balance: N/A
    • Exposure: N/A
    • Saturation: N/A
    • Contrast: N/A


Calibration

  • Distance between the smart phone cradle and drop = 8.7cm


Solutions Used for Calibration

Initial Concentration of 2X Calf Thymus DNA solution (micrograms/mL) Volume of the 2X DNA Solution (μL) Volume of the SYBR GREEN I Dye Solution (μL) Final DNA concentration in SYBR Green I solution (μL)
5 80 80 2
2 80 80 1
1 80 80 0.5
0.5 80 80 0.25
0.25 80 80 0.125
0.0 80 80 0.0



Placing Samples onto the Fluorimeter

  1. Put on your lab coat and a pair of gloves.
  2. Set up camera and slide. Make sure that the camera is at least 4 cm away from the slide.
  3. Pick up the micropipette and set it to 80 microliters.
  4. Put a new tip on the micropipette.
  5. Put the micropipette into the cyber green and collect 80 microliters.
  6. Put the cyber green onto the slide using the first two open spaces in the middle of the slide.
  7. Eject tip from micropipette and put a new one on.
  8. Put the micropipette inside of the positive control and take 80 microliters.
  9. Place the positive control inside of the cyber green that is currently on the slide.
  10. Turn on the blue light.
  11. Take 3 pictures of the mixture.
  12. Repeat these steps for the next 5 mixtures.



Data Analysis

Representative Images of Negative and Positive Samples

Negative Sample

Positive Sample


Image J Values for All Calibrator Samples

Final DNA Concentration in SYBR Green I Solution (µg/mL) AREA Mean Pixel Value RAWINTDEN of the drop RAWINTDEN of the background RAWINTDEN Drop - BACKGROUND
2.5331364198.732658525971764962148202976
2.5342228199.351682234211672492151498500
2.5250184199.32449867751124002048627731
1296560198.506588688471043789748430950
1281220197.943556654211013848145526940
1298592182.3754454217917207245282145
0.5348032174.117605984501045938050139070
0.5440128173.75764721631215283064319333
0.552859658.8231092099112906029963039
0.25464696145.554676381601135315256285008
0.2571805652.96738032999162601336406986
0.25686180150.2461030960021917750283918500
0.12568032456.65638544379647282932071550
0.125504300124.562628166872180238841014299
0.125516896124.628644197932299044141429352
061147638.40623484622493477418549848
0524308109.757575465182161086335935655
0647168108.69703405422721081443129728
Final DNA Concentration in SYBR Green I Solution (µg/mL) R1 R2 R3 RAWINTDEN Mean Standard Deviation
2.5482029765149850048627731494430691792680.019
1484309504552694045282145464133451751578.888
0.550139070643193332996303948140480.6717265123.92
0.2556285008364069868391850058870164.6723861019.82
0.12532071550410142994142935238171733.675286988.54
018549848359356554312972832538410.3312637190.3


Calibration curve
Image:LABCPLOTg4.jpg

PCR Results Summary PCR Dilutions:

PCR Tube Label Volume of Diluted PCR Product Solution (μL) Volume of SYBR Green I Dye Solution (μL) Dilution 1 Dilution 2 Total Dilution (simplified fraction)
G4 +8080(1/6)0.5(1/12)
G4 -8080(1/6)0.5(1/12)
G4 1-18080(1/6)0.5(1/12)
G4 1-28080(1/6)0.5(1/12)
G4 1-38080(1/6)0.5(1/12)
G4 2-18080(1/6)0.5(1/12)
G4 2-28080(1/6)0.5(1/12)
G4 2-38080(1/6)0.5(1/12)

PCR ImageJ Chart:

PCR Tube Label Area Mean Pixel Value RAWINTDEN of the drop RAWINTDEN of the background RAWINTDEN Drop - BACKGROUND
G4 +238260206.52849207455810222141105234
G4 +47503682.25939075423214085536934568
G4 +61474881.83550307831259611347711718
G4 -453896166.741756830441520465560478389
G4 -38966870.0727303846160856525695281
G4 -45330067.80530735807185697428878833
G4 1-146172066.51230710099166428029045819
G4 1-150108469.27534712669192326332789406
G4 1-1407032185.24753985691581904059579529
G4 1-2382272185.781710188671444676056572107
G4 1-2379832185.004702703291293091657339413
G4 1-254662077.23642218650200950740209143
G4 1-3424532171.574728388111365118359187628
G4 1-3350160169.81259461422105494058406482
G4 1-363621279.32150465104252907447936030
G4 2-1342228176.66960461158891635151544807
G4 2-1352960193.364682497271044295557806772
G4 2-1477744195.70393495795904211384453682
G4 2-2327048192.78863050943983036253220581
G4 2-2627364192.62912084879016995345103853445
G4 2-2513836193.179992621281388777085374358
G4 2-3305496155.53447514967781863739696330
G4 2-325764066.8471722249777235416450143
G4 2-3234740183.90943170690708644636084244

PCR DNA Calculations:

PCR Tube Label RAWINTDEN Mean PCR Product Concentration (μg/mL) Initial PCR Product Concentration (μg/mL)
G4 +41917173.330.6390577780.053254815
G4 -38350834.33-0.549721889-0.045810157
G4 1-140471584.670.1571948890.013099574
G4 1-251373554.333.7911847780.315932065
G4 1-355176713.335.0589044440.42157537
G4 2-164601753.678.2005845560.683382046
G4 2-28081612813.6053761.133781333
G4 2-330743572.33-3.085475889-0.257122991
  • Our positive control PCR result was 0.053254815 μg/mL
  • Our negative control PCR result was -0.045810157 μg/mL

Observed results

  • Patient 16819 :

The droplets for patient 16819 had a big green area of DNA in the middle of the drops. DNA was not found around the top or bottom of the drop. Small amounts of green touched the sides of the droplet. Based on the calculation the amount of DNA for patient 16819 is 0.250202 μg/mL.

  • Patient 59134 :

The droplets for patient 59134 had more green in comparison to those of patient 16819. The green concentrated in the middle, touched the tops of the droplets, more densely touched the sides of the droplets, and still did not touch the bottom. Based on the calculation the amount of DNA for patient 59314 is 0.520013.

Conclusions

  • Patient 16819 :

After a comparison of the values of positive and negative controls compared to the values of patient 16819, it was determined that the values fell closer to the positive control. For this reason patient 16819 was determined to be positive for SNP.

  • Patient 59134 :

After a comparison between the values of the positive and negative controls to the values of patient 59134, it was determined that the patient's values fell closer to the positive control. Because of this, patient 59134 was determined to be positive for SNP.

Error Analysis: Errors were known to have occurred because some of the values obtained are impossible (negative values). The software was used correctly with accordance with the procedure explained in the Lab Workbook. After examination, some of the error can be attributed to different sized images of the droplets because they were taken with different zooms, causing error in the ImageJ calculations. The camera was alinged manually to the droplet each time, but zooming was necessary, and a standard zoom was not determined at the time of taking the pictures.




SNP Information & Primer Design

Background: About the Disease SNP

Part 1: What is a Nucleotide? A nucleotide is the primary building block of nucleic acids. They are composed of a nitrogenous base, a five-carbon sugar, and a phosphate group.

What is a Polymorphism? A polymorphism is when two different phenotypes exists in the same population. For example, there are cheetahs who display a spotted fur, and there are cheetahs who display black fur.

rs268 This variation is found in homo sapiens. The variation is located on chromosome 8 The clinical significance of this SNP is that it is pathogenic. This SNP is associated with the LPL gene A disease associated with this SNP is Coronary Heart Disease

Part 2: LPL stands for Lipoprotein Lipase The LPL has several functions: apolipoprotein binding heparin binding lipoprotein lipase activity

An allele is a varying form of a gene. The disease-associated allele contains the sequence: AGT The numerical position of the SNP is: 19956018


Primer Design and Testing

When run through the primer test, the non-diseased primer was found to be in the human genome. This is because it is normally produced in the body. Conversely, the diseased primer returned no match because it does not appear in a healthy human genome, as it is a mutation.

The non-disease forward primer (20 nt): 5’ AATCTGGGCTATGAGATCAA

The numerical position exactly 200 bases to the right of the disease SNP is: 19956218

The non-disease reverse primer (20 nt): 5’ TGGGACTCGGGACCACAAAG

Disease forward primer (20 nt): 5’ AATCTGGGCTATGAGATCAG

Disease reverse primer (20 nt): 5’ TGGGACTCGGGACCACAAAG



Personal tools