BME100 s2016:Group13 W1030AM L4

BME 100 Spring 2016	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Andrej Sodoma Name: Shantelle L. Woody Name: Slade Role(s) Name: Brian Lambert Name: Bradley Name: Najila Alamro LAB 4 WRITE-UP Protocol Materials Lab coat and gloves PCR reaction mix, 8 tubes, 50μL each: Mix contains Taq DNA polymerase, MgCl​, and dNTP’s DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer. A strip of empty PCR tubes Disposable pipette tips Cup for discarded tips Micropipettor OpenPCR machine PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G13 + Positive control none G13 - Negative control none G13 1-1 Patient 1, replicate 1 39590 G13 1-2 Patient 1, replicate 2 39590 G13 1-3 Patient 1, replicate 3 39590 G13 2-1 Patient 2, replicate 1 63142 G13 2-2 Patient 2, replicate 2 63142 G13 2-3 Patient 2, replicate 3 63142 DNA Sample Set-up Procedure In order to perform PCR reaction: 1- Eight test tubes were used labeled G13 P, G13 N, G13 1-1, G13 1-2, G13 1-3, G13 2-1, G13 2-2, G13 2-3. 2- For the G13 P test tube the DNA from a person who tested positive for the disease SNP was placed inside. 3- For the G13 N test tube the DNA from a person who does not carry the disease SNP was placed inside. 4- For the G13 1-1 test tube an unknown containment of SNP in DNA strand was placed inside. 5- This was repeated for G13 1-2 with replicate 2 and G13 1-3 for replicate 3. 6- 50 μL of PCR reaction mix containing Taq DNA polymerase, MgCl , and dNTP’s was placed into each of the eight test tubes using a micropipette. 7- 50 μL of DNA/primer mix was placed into each of the eight test tubes using a micropipette. 8- After each test tube was injected with a material the tip was disposed of in a discard cup and a new tip was put on. This was done to ensure no cross contamination and a sterile field. 9- Steps 4-7 were repeated for patient two. OpenPCR program HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 25 Denature at 95°C for 30 seconds Anneal at 57°C for 30 seconds Extend at 72°C for 30 seconds FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C Research and Development PCR - The Underlying Technology Polymerase Chain Reaction (PCR) is a process that uses four different components to replicate a specific strand of bases. The four parts to PCR are the DNA template, primers, taq polymerase, and deoxyribonucleotides. The DNA template strand is extracted DNA from a sample of hair, blood, saliva, or skin cell. Primers are the short pieces of DNA designed in lab to amplify the desired strand of nucleotides in the DNA template. Taq polymerase goes along the DNA strand attaching nucleotides. Deoxyribonucleotides are the building blocks of DNA which are adenine, thymine, guanine, and cytosine. The initial step to PCR heats the four components in the test tube to 95 C in order to break the DNA template. Then after another 30 seconds the DNA template was denatured into two identical strands. The two identical strands were then cooled slowly (anneal) to 57 C causing the primers to attach to the forward and reverse DNA strands. The solution was then heated to 72 C causing the DNA polymerase to to attach and add dNTPs to the forward and reverse primers in the five prime to three prime direction. The solution was then held at 72 C for three minutes which isolated the fragments. This process was repeated thirty times which caused the production of billions of fragments. After thirty cycles the solution was held at 4 C containing the target sequence for storage. SNP Information & Primer Design Background: About the Disease SNP SNP is a discontinuous genetic variation on the 19th chromosome associated with protein coding. The location of this variation is at the number position of 17811986 in the DNA sequence. The variation is an allele which is a variant form of a gene, of the sequence CGC not CAC, which is what the gene is supposed to be. The variation in this gene is linked to non-Hodgkin lymphoma (NHL), which is a cancer that starts in the lymphocytes. This is because SNP is related to genes that are related to immune function, which if a variation is present one is then predisposed to NHL. Primer Design and Testing The primer is designed to detect a single nucleotide polymorphism in the DNA sequence (SNP). In order to design the PCR, first the location of the SNP had to be found, the numerical location of the SNP on the DNA sequence was 1781198. After the SNP was located the non disease forward primer was able to be determined. The non disease primer consisted of twenty bases ending with the SNP base, resulting in this twenty base sequence GTGCGGGCTCCATCGCAACG. The non disease reverse primer was found by moving to the numerical position of 17812186 which is 200 bases away from the last base of the non disease forward sequence. The reverse strand was then read five prime to three prime (from right to left), starting at the 200th base from the position of the SNP and then stopping after 20 bases. This resulted in GGAGGAAGGTGTCGCCCCTT as the non disease reverse primer. The disease reverse and forward primers were then placed into the UCSC ln- Silico PCR website. The settings were then changed to: Target: genome assembly Maz product size: 4000 Min Perfect Match: 20 Min Good Match: 20 Flip reverse primer: unchecked This was done in order to make sure that the website was comparing the correct DNA sequence to our primers. Validation that the non-disease primer was found. This screenshot shows a result of a 220 base pair sequence from the nineteenth chromosome showing that the non disease sequences that we made were correct. After this was approved the disease forward primer was found. This was done by leaving everything the same from the non-disease forward primer but switching the SNP from guanine to adenine. Resulting in GTGCGGGCTCCATCGCAACA as the resulting disease forward primer. The disease reverse primer was the exact same as the non disease reverse primer. This was because the the SNP was the only base that needed to be corrected allowing for the other bases to remain the same. The disease forward and reverse primers were then plugged into the website with the same settings as the previous sequences we plugged in. Validation that the disease primer was found.This screenshot shows a result of no matches meaning the disease forward and reverse primer are correct. This works because the database only detects human genomes therefore disease genomes are not able to be recognized resulting in “no matches” when the sequence was correct. These primers will then be replicated a billion times via the process of PCR. Once there is enough of the primers they can then be collected and used to correct the SNP by injecting the correct DNA sequence into the cell resulting in the production of cells without the disease NHL.