Berglund:PCR: Commonly Used Primers

From OpenWetWare

Jump to: navigation, search

Contents

Plasmid primers

SELEX primers

N30.2F: 5' gat aat acg act cac tat agg gaa tgg atc cac atc tac ga 3'
N30.2R: 5' aag ctt cgt caa gtc tgc agt gaa 3'

0 bases from the MCS

pcDNA3 Forward: 5'ATTAATACGACTCACTATAGGGAGACCC
pcDNA3 Reverse: 5'AGCATTTAGGTGACACTATAGAATAGGG
pGEXF1: 5'CTG GAA GTT CTG TTC GAG
pGEXR1: 5'CGT CAG TCA GTC ACG ATG

35 bases from the MCS

pGEXF2: 5'CGACCATCCTCCAAAATCGG
pGEXR2: 5'CCGTCATCACCGAAACGC

50 bases on either side from the MCS

pGEXF3: 5'ggg ctg gca agc cac gtt tgg tg
pGEXR3: 5'ccg gga gct gca tgt gtc aga gg
pUC19 F: 5'GGATGTGCTGCAAGGCGATTAAGTT
pUC19 R: 5'TTCCGGCTCGTATGTTGTGTGGAAT


100 bases on either side from the MCS

SP6F1: 5'gat atc aca gtg gat tta
SP6R1: 5'att tag gtg aca cta tag


Other

T7primer: 5'TAA TAC GAC TCA CTA TAG GG
pcDNA3 F1: 5'ATT AAT ACG ACT CAC TAT AGG GAG ACC C
pcDNA3 R1-RT Primer: 5’ AGC ATT TAG GTG ACA CTA TAG AAT AGG G
TNNT2 F1 (cTNT): 5'-GTT CAC AAC CAT CTA AAG CAA GAT G
TNNT2 R1 (cTNT): 5'-GTT GCA TGG CTG GTG CAG G
MBNL1 F1 (short): 5'-GAT CAA GGC TGC CCA ATA CCA G
MBNL1 R1 (JP): 5'-CAG ATT CAT TTA TTA AGA AAC CCC ACC CCT TAC
Serca F1:RT Primer (Stacey): 5'-ACC TCA CCC AGT GGC TCA TG
Serca R1:RT Primer (Stacey): 5'-CCA CAG CTC TGC CTG AAG ATG TG
RTlacSERCA1-e21 F1: 5'-GTC CTC AAG ATC TCA CTG CCA GT
RTlacSERCA1-e23 R1: 5'-GCC ACA GCT CTG CCT GAA GAT G
INSR RT Primer (vector specific): 5'-TCG TGG GCA CGC TGG TCG AG
INSR F1 (DM1-splice): 5'-CCAAAGACAGACTCTCAGAT
INSR R1 (DM1-splice): 5'-AACATCGCCAAGGGACCTGC
ATP2A1 F1 (DM1-splice): 5'-TTCGTTGCTCGGAACTACC
ATP2A1 R1 (DM1-splice): 5'-GGTTGGGAAGGGGAATTTAC
DUP RT Primer and R1: 5'-GCA GCT CAC TCA GTG TGG CA
DUP F1: 5'-GAC ACC ATG CAT GGT GCA CC
pcDNA3-R1 (RT Primer PLEKHH2-SM1F): 5'- AGC ATT TAG GTG ACA CTA TAG AAT AGG G
PLEKHH2-SM1 F1: 5'-GCT GCA GAA TGA AAT TTG CTG TCA G
PLEKHH2-SM1 R1: 5'-GTC ACC ATT TTG TTG CGT TCT TTC TAC
Personal tools