Berglund:PCR: Commonly Used Primers

From OpenWetWare

Jump to: navigation, search

Contents

Plasmid primers

SELEX primers

N30.2F: 5' gat aat acg act cac tat agg gaa tgg atc cac atc tac ga 3'
N30.2R: 5' aag ctt cgt caa gtc tgc agt gaa 3'

0 bases from the MCS

pcDNA3 Forward: 5'ATTAATACGACTCACTATAGGGAGACCC
pcDNA3 Reverse: 5'AGCATTTAGGTGACACTATAGAATAGGG
pGEXF1: 5'CTG GAA GTT CTG TTC GAG
pGEXR1: 5'CGT CAG TCA GTC ACG ATG

35 bases from the MCS

pGEXF2: 5'CGACCATCCTCCAAAATCGG
pGEXR2: 5'CCGTCATCACCGAAACGC

50 bases on either side from the MCS

pGEXF3: 5'ggg ctg gca agc cac gtt tgg tg
pGEXR3: 5'ccg gga gct gca tgt gtc aga gg
pUC19 F: 5'GGATGTGCTGCAAGGCGATTAAGTT
pUC19 R: 5'TTCCGGCTCGTATGTTGTGTGGAAT


100 bases on either side from the MCS

SP6F1: 5'gat atc aca gtg gat tta
SP6R1: 5'att tag gtg aca cta tag


Other

T7primer: 5'TAA TAC GAC TCA CTA TAG GG
pcDNA3 F1: 5'ATT AAT ACG ACT CAC TAT AGG GAG ACC C
pcDNA3 R1: 5’ AGC ATT TAG GTG ACA CTA TAG AAT AGG G
Personal tools