Biomod/2014/CACGTAATTGACGCCAGCTTTGAAT

From OpenWetWare

Jump to: navigation, search

Mainpage

Logo TU Braunschweig our group Logo Nanoscooter

Team Nanoscooter Braunschweig

Home
Team
Project idea
Results
Perspectives
Sponsoring


Materials

The chemicals were purchased from Sigma Aldrich, oligonucleotides from MWG Eurofins, yellow green fluorescent beads and 10X BlueJuice™ Gel Loading Buffer from Life Technologies and Pt-nanoparticles from Nanocomposix.



Table 1: Buffer list.

BufferIngredients
1X TE10 mL 1 M Tris-HCl (pH 8)
2 mL 0.5 M EDTA (pH 8)
988 mL water
10X TE100 mL 1 M Tris (pH 8)
20 mL 0.5 M EDTA (pH 8)
880 mL water
PBS8.0 g NaCl
0,2 g KCl
1.42 g Na2HPO4
1.78 Na2HPO4• 2 H2O
0,27 g KH2PO4
1000 mL water
TBE 10.8 g Tris
5.5 g boric acid
0.7 g Na2EDTA
1000 mL water
TAE 4.84 g Tris
1.1 mL acetic acid
2 mL 0.5 M Na2EDTA
997 mL water
Phosphate buffer 400 mL 1 M KH2PO4 solution
500 mL 1 M K2HPO4 solution
LB medium >10 g/L NaCl
10 g/L Bacto-tryptone
5 g/L Yeast extract
in ddH2O, autoclave
DYT medium 16 g/L Bacto-tryptone
10 g/L Yeast extract
5 g/L NaCl
in ddH2O, autoclave
Buffer M1 150 g PEG-8000/500 mL
87.66 g NaCl/500 mL

10mM Tris 121.14 mg Tris base /100 mL
Adjust to pH 8.5 with HCl

Buffer PPB2 1.6 g NaOH/200 mL
2 g SDS/200 mL
Buffer PPB3 58.88 g C2H3KO2/200 mL
Adjust pH to 5.5 with glacial acetic acid


DNA Origami Folding

Supporting information.


Table 2: Staples for Mastermixtures.

MastermixStaples used for the unmodified NanoscooterMastermixStaples used for the Nanoscooter modified for
modified for platinum nanoparticle binding
platinum nanoparticle and bead binding
N1unmodified staples: N1_A1 - N2_E9N3staples modified with 15 adenines: rot1_15A -
orange3_15A
N2unmodified staples: rot1_unmod - orange3_unmod N4unmodified staples N1_A1-N2_E9 without N1_B1,
N1_D8, N1_G9, N1_G11, N2_C7
N5staples modified with 15 adenines: rot1_15A -
orange3_15A and biotin modified staples

The sequences are shown in the attached file (List of staples).

Table 3: Components for DNA origami folding.

Componentsunmodified NanoscooterNanoscooter modified for
platinum nanoparticle binding
Staples used for the Nanoscooter modified for
platinum nanoparticle and bead binding
volume [µL]volume [µL]volume [µL]
Mastermix N13232-
Mastermix N210--
Mastermix N3-10-
Mastermix N4--30
Mastermix N5--10
MgCl2 (100 mM)181818
MilliQ water202022
10x TE buffer101010
Scaffold p8064 (100 nM)101010


Table 4: List of staples.

Oligoname Sequence
N1_A1 CACGTAATTGACGCCAGCTTTGAAT
N1_A2 CCGCTTTTGAGGCTTAGTAAAAGGAT
N1_A3 GTGTACAAGAATCGCAACGCCAACATGT
N1_A4 GGGTCGTAACCTAAGCCCGAAAGACTTC
N1_A5 CAATAGAAAATTCAAGTTTATAAACGTCA
N1_A6 AGCTTGCAGGTAGATTGGTCTTGATACCG
N1_A7 ACGTAACTAACCTCATCTTTGACCCATTA
N1_A8 TCACGGCGGATGGGATAGGTCACGTGGGCGC
N1_A9 GCTTGACCATAACGCCTTTCACATCAAAAAT
N1_A10 ACCGTCACCATTTGCATTACCCCTCAGAGCCG
N1_A11 TACCCAATGAGCATGTAGTCCCTGACGAAACG
N1_A12 AGTCAGGCATTTGTTTTGATACATTAAAATCA
N1_B1 TGCGCGCCTGTTAGCCTTAGAACCCCTCAAAT
N1_B2 TAAACCTTAGGTTGGGTAACACCGATAAATAAG
N1_B3 AGTTTGCAGACTGTAGCGCGTATTTTCGTTCATAA
N1_B4 AGCAACTTCAAAGATTGCTATCGAAACCGTATTAG
N1_B5 AGGGAACTGATTTAGATACGAGACCTTATGCACTG
N1_B6 CAGAGCAATCTAATAGAAACTAAAGTTTGAGTGAA
N1_B7 TTAGCATATTAAATAACAACCAAGAATAGGGTTGA
N1_B8 TACATCATCGAAATTGTGTCGAAATCCGCGACAAC
N1_B9 GACAGCCGCGTAACCCGGCACCGCTTCTGGTGCCC
N1_B10 CTCAAGTGGGACGAGGCCTCAGGAAGATCGCACTC
N1_B11 ATAACGGAAAGATTTTGGCCGTCTCGTCCTCAAGG
N1_B12 GGGCGCCTTCTTTTGAGGTGGAGTTTAAAAATACC
N1_C1 GGTGTGTGTAAACTAACTCTAACGGCATGGTGCCC
N1_C2 AATTACGTGAACCATCAGTTTTTTACCCTAACGAT
N1_C3 CAAAGCGAAAGACAGCAGATCGTCCAAAAGAGAGGG
N1_C4 CTTTCGCGCTTACGTGGTGCTGGAAGTTTCATTCCA
N1_C5 ATAATGATTGCAAGTTACAATCGGCTTTCAAACTGC
N1_C6 AGGCTAATTTACGCTAACGAGCGTCTGTACCGCTCATT
N1_C7 AAAGAATGAACGGTATACCACTGCAGATACATAACATT
N1_C8 TCTCAATCACCAGCTGGCAGCATTTCGGTCTGAAACAT
N1_C9 GCTTTACTTAGCCGGAAGCAGACGTGAAAGAATGAACG
N1_C10 AATATGGTTTAATTTCATTGTGAACCAACTTGTCAATC
N1_C11 ACTAAAGCGCCGTGGCGGAGCTTGACGGGGAAGCACTA
N1_C12 TCGTCTATCAGGGCGATGGCCCACCTCCAAAATAATAA
N1_D1 GGAGCTTTCACACCAGTACAGCTGATTGCCCGGCCCTG
N1_D2 AGAAAGGAGGACTCATTTAAGAGGCGTCGTTAAATCCT
N1_D3 GAACAACGCTCCAATAGGCGAAAAAAATCCGTGCATCTG
N1_D4 TTAGAGCTAAGTTACTCATGAATCCTGTAGCATTCCGCA
N1_D5 GCGTGGTGTACGGTGTGTCATTCACGCTGCGGCCACGAT
N1_D6 AACAGCATGCCCTGCTTTAAACAGTTCAGATGCCAAGTT
N1_D7 GTCAGACGATTGGCCTTGATTATTTGCAAAATAAAAGAT
N1_D8 AATGACAACACGTGGTTCTCACCGGCTTTAGCCACTGCAA
N1_D9 GCCAGTAGACAGGCAAATTTCCATAGGGCTTAATTGGACC
N1_D10 ACAAACTACAACGTTTTACCCATAGGAAGTACCCTCCGCC
N1_D11 TATAACAGTTGATTCCCAATCTCAACAAAAGGGTGGAGACA
N1_D12 ATTCGGTCATCGCCAATACTGCGGAATCTTAGACTTGTTTC
N1_E1 TAATGCGAACCACCACAGGCGCTGCACAGCAGAAGGGTGAGG
N1_E2 CAAAATGTAGCATGAATCGATACAAGGCCTACAACTAAAACA
N1_E3 AAACAGGAGACGGGAGAATTAGAGTAATAGATTCATGTTTTA
N1_E4 ACGCTGCGCGCTGGCGGATCGAGGGCGTCAGTATTGCAACAG
N1_E5 AAGGAAAACAAGAGGTATTAAATTGCCCGTTAACATATTCCT
N1_E6 TGAGTGAAAAACAGATGGATTATTCATTCATTACATTTAACA
N1_E7 CCAGAGCTCATTGCGGAGCAATTTAATTCGGTGCCCTGGGAG
N1_E8 TCTCGTCGAGTTCCGACTTCAATCAAAATCTGGCCCCCCTCA
N1_E9 CGGAGCTAGCGGTTGCGCTCAGCCAACGAGCGCCAACCGGAA
N1_E10 ACAATCGCCTAAAACAGGCCAACGACTCGCCATTAACGAACC
N1_E11 ATATGTTGCAGTTAGCGTTTGGATAAGAATGATGCCACCACC
N1_E12 TAGTTAATACAGCAAACGTTTCAAACTTTAGAGCGCAACCAA
N1_F1 AAAAAATCCCGTAAGGGTAAAGCGGTCCCAGAGCAAACGTCA
N1_F2 AATTAGACAGGAACCCAGAATGTTTTTAGTGAGGCAAGAGTC
N1_F3 GTGATTAAGTTTGTAAAGTGCCAATAACCTCTGTTTACCAGT
N1_F4 CAGAAACAGGATTAAAGGGATTCATACGAGCTTAATTGAGAC
N1_F5 GGAACAAGGTAGAAAGATTCATTTAGGAAATACGAGCCACTC
N1_F6 GGTCAGTACAGTGCCCGCATTGAAGCGTATAAACACCTGCCT
N1_F7 ACTACCTTTTATCAAACGCTGAGAAGAGTGCGATAGCTTAGA
N1_F8 TAAGGCTATCAACGCAAGAACCAAATTCAAAGCCAACGCTCA
N1_F9 GGAAGTTGTAATGTAATTGAGCGCTAATTGAACAATTTTCAT
N1_F10 AGAGAGTTGCAGGTCCGGGCAGAGACGCGCGGTTTGCGTATT
N1_F11 AGCACCGTGCCGGACTTGTAGCATCCTCAATTATCAGAAACC
N1_F12 AGCCCAATGTACCGGAAAGGGCCTCTTCATCCTGTTTCCGAA
N1_G1 ACAGCGGGCATCCCAGATACATTCTGTGCGCGCTCGCAAATG
N1_G2 GTCGGGAGCCAGCTGGAATTTGTTTGATCCCGGGAGAGATAG
N1_G3 AGCCATACAATCCAAATAAGAATGCCGGTATTTTTAAACTCC
N1_G4 GTCAAATATGATATTCATTTTTGGAGCCTCCGTCGGATGGCT
N1_G5 CTGCCAGCACGCGTGCCTGTTCTTCGCGTCCTCACCGTCTCG
N1_G6 AATATGCAACTAAAGCTGGTCTGGGTAAGTGTAGTCAGCAGC
N1_G7 ATCGGCAAAATCCCTTATAAATCAAATAGTCATAACGTCGGA
N1_G8 AAAAATATTATAACCTGAAAATAGCAGCCTTTGTTTAACGTC
N1_G9 TAGTAACCGGTCTGTTATATTTGGCAACAGGAAGATTGTAGT
N1_G10 CTCCGGCGTTTTTTAGTTGAGATGGTCATAGCTGTAAATTGT
N1_G11 CGCCAGGGTGTTAATTTTTTTTCCCAGTCCACCCTGATAGCA
N1_G12 TCACGCAAATTAGGGCCGTTTACCGGGGGTAGTAACACCGTT
N1_H1 ACAGTTTAGAATAGAACAAGCTATTTTCTCTTCCAGACGTTA
N1_H2 CCATAACTAGTATGCATCAGAGAATGCGATCCCACCAACGGC
N1_H3 AGTGAATTTTAACCTCCGGCACGGAATATATGGTTAAAGACAA
N1_H4 TGATAGCGCCTATTAATGGGAAACGTACCGAACGTCGTATCGG
N1_H5 AAAGCTATTACGTCGCGATAATCCAGCTGGCTAACACTACCAGT
N1_H6 ACGATTCCATTACTAAAGACTTTTTAACGAGGTAAAAACAGAGG
N1_H7 CCAGACAGGAGGAAGAATTTTTTTAAAGCCATTTCTTTCCCTGCG
N1_H8 CCAGTTTTGTCGTCTATAATAGCAATATAGAGGTATTCAGGCGTT
N1_H9 TACGGGAGAATCCTGATTGTTTGGTGAATAAAGAACCTAATATTC
N1_H10 AAACTAAATTCAATAGTTACACATTAACAGTACCTTTAATAATCT
N1_H11 GACCAGTAGAGTAGCACGGAATTAGAGCCAGAAAGGTGTAAATAT
N1_H12 GGAGAGTACAGGGCGCGTACTATGGTTACGAGCAGCTTTCCGAAT
N2_A1 TCATATGCGTACTAGAAAAGAATATATATAAATGCTGATGCAAAT
N2_A2 CAGAGCATTAGCAACGGGTTACCCGAGCGGGCGTGGCTGGTAATA
N2_A3 TAATTTAGCGCAAAAACGCGCAACTAAGAATCAAAAAGAAAGCCC
N2_A4 AGGTAATATGCCGTTCCGAGAAGTCCTGAGCTCGAATTTCCACAC
N2_A5 TAAGCCACCACATTAGCAAGCAGCATTAATTAATTTTCCGACATTC
N2_A6 CGGGCGCAAGGGAATGCGGAAACCAGGCGTTGGGAGTGCGGGGGAT
N2_A7 AAGTGTGTTCCTCAGGTCAGGATTAGAGCGGAAGCGAGAGATTATC
N2_A8 TGAGAACTTAAATAGTCTCTGAGTTCTGCTCAGGGTTTTAGGCGGA
N2_A9 GTAGCACTTAGGAAATGTTTTAAGCCGATGGGATTATTGAGGAAGG
N2_A10 TAAGTGCGTTGATATAAGTATAGGTGTATCACCGTTTTAGTAGAAC
N2_A11 CAGAAATCATAATTTAAAGAAAGAGCTACGGATATTAGGCTGAGTA
N2_A12 AAACAAAATTAAAAATCACCAGCAAAAGAAGATGATTCATTTACAG
N2_B1 ATAAGGGCTCCATGCAATAATTGAATTTATACCAGGGGAAGAGATT
N2_B2 AATCGATCCCCGGGTACCGGCAAACGTTAAACGATGCTGCGACATA
N2_B3 GAACAAAATAATCGTTTCCTTATCGCCCTACCGCAATCGTAATGTA
N2_B4 GTAAAACAGGAAGTGGCATAGACTATCATAACCCTACGACGAGTAG
N2_B5 ATTGAATCTTCCTGTCATCAACTTACGAGGAAACCAATTATCCAGGC
N2_B6 CCCGCATTAATGAATCGCTGCCCGACTCACACGGAAGCTCACAATCGT
N2_B7 CAAGATTATAAGCATTGTAAATTATAGTCGGTTTAGGGTAGAAGCAAA
N2_B8 TGTTCCAGCACGACTCCAGCATTAAAAGCCGACTTACAATAAGAGAAT
N2_B9 AAGGGCCTTAGAAATGAAACTGGCAACAACTGGCCTCCTTAAGTCAGA
N2_B10 TAGAGCTTAAGAGGTCAACCGTAAATTAAACGATTGTTACAAAATAAAC
N2_B11 TTAAGAAAGGTAGGTGGTTGATGGGCCAAGCGGTCCACGCTGGTTGGCG
N2_B12 ACAAACAAATAAATAGCGTCAAGCCGCCCAGAGTACAATTACTCGCGCA
N2_C1 CGGCTACTTTGAGGAAACGGGACGTAATAGGCACCAAACGAAAGAGGCA
N2_C2 GCAGGCGTGTACTGTTAACGGGGAACCACCATCTTGTCATAGCCCCCTT
N2_C3 GTGTTGTAACAAGAGTCCACTGTGGACTCCAACGTAAAACCGGTTTATC
N2_C4 TTTTTTCCCCTCAATCGAATTTAAAGAAGTGAGTGCAGCGTGAGTTGAA
N2_C5 GATAAACCGAGAAATAGATATAAAAAAATACATACATAAAGCGTCCTTT
N2_C6 TTGTACCTCATACAGTGGCATCAATTCTGTTTAGCAACGCAATTTTAGA
N2_C7 CTTCAAAGCGAACCATCGCGTACAAGAGTCAATCAGAATCTTTTGCACC
N2_C8 CAGATAGCCGAACAATAGCTAATTGAGTTTTTGCGTTATTTCTATATTT
N2_C9 GCCTGGAGAGGGTAAAGGGAATGGATCTGAATCACCCTCAGACGGATAA
N2_C10 GGCAATTCAGAGTAGCCTTTCTGATGATTCCAGTACCTCATTGAGGCAG
N2_C11 TTAATTTTATTAGGATTAGCGTTTGCCGCGGATCATGAGCTACTTTCCA
N2_C12 TGCTTTTACCCGAAAATGGATACATCACCCTGTAATACTAAGCCCGAGA
N2_D1 CAGCCAGGCGCAGTGTCACTGCACTCTGGCTGGAGGTGTCCAGGTCATT
N2_D2 GCCACGGCCGCCACGCCACCCTCAGAACAGAGCCACACGACGTGGGTAA
N2_D3 GTCAATAGACCATTTCATATAAATGCCTACTGAACAGAGAATAACATAA
N2_D4 GAAAGCTGAGATGATGAAAAAAAGCTATCCGCATAAAGTGTAAAGCTAA
N2_D5 ACGCTGACAAATGAAAGTATCCGACAAATCTAAAGTCACCTTGCTGAAC
N2_D6 TGGACGCTCCGGTATGAGCCGGGTCCCGCCGGTGGCTTTAATATAAACA
N2_D7 CATTCCAGAACCACCACCAATATACTAGGGTTTGGAACAGCGCGGTTGA
N2_D8 GCGGATTCCTGACTACGTTAAAAATTCGTCAACAAAGTCCTGAAGCGGG
N2_D9 CAGCTACAAGGAATAGCCCTTTTATCCTTATGTACAATCAGAATTAAGA
N2_D10 CGGCGAACATTCGCCACGAGTGTGAGTTCAGGCTGCAACGCGTAAGACA
N2_D11 CAGGTCTACGAGAACATTTTTGAACGCCAGAAAAACCCATCCTAGAACC
N2_D12 GCAGAAGGGATAGCTCTCAACGTGAGAATCGACAACCCGATAGATATAA
N2_E1 AACCGATTGAGGGAGTCGCTACCGTAATAGAATCAGGAACCGAATCACC
N2_E2 CTTCTGAATGGTTTCCGTGTGGAGGAAACCGAGGAAACGCAAATACCCA
N2_E3 ACTTTCTCCGTGGTGAAACAGCCAGCAGTTGGGCGGTTGTGTGAAAAAG
N2_E4 TGGTGCCGCACCGTTGTAGCACTTTGATATCACTTGTAGAAGATCGGCC
N2_E5 TCTCGCCCGGATAACCTCCCTACCCTCAGAACCGCTTACCGTACAGGAG
N2_E6 TGTCAAGCGCGAAACAAAGGCTGATTCTATACCAGGCCGAGAATGAAAA
N2_E7 GGAAATGCTCCTTTTGATAATTGCGCTGTAGTCTGCGATTAGTTTACTT
N2_E8 CGCACAGGCGTAGCAGAGGGGCCTTTAGCTTATCCTTATTCCTCAAGAG
N2_E9 AATCGGAGGGGTCGAGGTGCCGTAGAACATTAAAAAAAGATAGCCCGGC






rot1_unmod CATATAAACATCCCTTACAGCCAGTTACCCT
rot2_unmod CCACGGTGCCCAGATGCAATTAAGCAAAATCTCAG
rot3_unmod AACCGCAAGAATGCGCAACCAACTCAATACTGTTGGCTCGTCAAAGCCT
rot4_unmod TCATTTGTGAAAAGGGCAAGGCAAAGAATAAAGCTAAATCGG
rot5_unmod GAGTGGGCCTACTAATATAACATCCAATAAAAAAAACATTATGAT
rot6_unmod AGTGCTGACCTTCATCAATCTTGATAACAAA
gelb1_unmod TCAGATGAGTGCGTGAAATAGCCGCCGCCAG
gelb2_unmod AACCCACAACAGTCAAGCGGATCTTACCGAAGCCCAAGTAAG
gelb3_unmod ACAGTCAAATAATAACAATGAAATAGCAAAGTTAC
orange1_unmod TGACGGAATAACCTTGCTTCTGTAAATCGGGAAGGAATTATC
orange2_unmod AGGCATCGATAGGCCGGTTTGTCACATTGAGCCGACAT
orange3_unmod CAAGACACGCACATCCTTGAAAACATACAGCGCCTACCAAT
rot1_15A CATATAAACATCCCTTACAGCCAGTTACCCTAAAAAAAAAAAAAAA
rot2_15A CCACGGTGCCCAGATGCAATTAAGCAAAATCTCAGAAAAAAAAAAAAAAA
rot3_15A AACCGCAAGAATGCGCAACCAACTCAATACTGTTGGCTCGTCAAAGCCTAAAAAAAAAAAAAAA
rot4_15A TCATTTGTGAAAAGGGCAAGGCAAAGAATAAAGCTAAATCGGAAAAAAAAAAAAAAA
rot5_15A GAGTGGGCCTACTAATATAACATCCAATAAAAAAAACATTATGATAAAAAAAAAAAAAAA
rot6_15A AGTGCTGACCTTCATCAATCTTGATAACAAAAAAAAAAAAAAAAAA
gelb1_15A TCAGATGAGTGCGTGAAATAGCCGCCGCCAGAAAAAAAAAAAAAAA
gelb2_15A AACCCACAACAGTCAAGCGGATCTTACCGAAGCCCAAGTAAGAAAAAAAAAAAAAAA
gelb3_15A ACAGTCAAATAATAACAATGAAATAGCAAAGTTACAAAAAAAAAAAAAAA
orange1_15A TGACGGAATAACCTTGCTTCTGTAAATCGGGAAGGAATTATCAAAAAAAAAAAAAAA
orange2_15A AGGCATCGATAGGCCGGTTTGTCACATTGAGCCGACATAAAAAAAAAAAAAAA
orange3_15A CAAGACACGCACATCCTTGAAAACATACAGCGCCTACCAATAAAAAAAAAAAAAAA






instead of N2_C7, N1_D8, N1_B1, N1_G9, N1_G11
76[77] CTTCAAAGCGAACCATCGCGTACAAGAGTCAATCAGAATCTTTTGCACCB 49 #57bb00 3' Biotin
45[87] AATGACAACACGTGGTTCTCACCGGCTTTAGCCACTGCAATAGTAAC 47 #57bb00
75[70] TTAGCCTTAGAACCCCTCAAAT 22 #57bb00
74[77] CGGTCTGTTATATTTGGCAACAGGAAGATTGTAGTTGCGCGCCTGB 45 #57bb00 3' Biotin
72[56] CGCCAGGGTGTTAATTTTTTTTCCCAGTCCACCCTGATAGCAB 42 #57bb00 3' Biotin
Figure 1: caDNAno-File of the Nanoscooter.

Personal tools