Davidying: M13.1 Design
From OpenWetWare
Contents |
New M13.1 Design
Modifications
I moved the g8 promoter closer to g8 ORF in order to examine the results. In the process I had to unstuff various genetic elements involving g7 and g9, while I left other overlapping elements untouched if I felt it was not important to the study.
Gene 7:
- RBS: gttccggctaagtaac
- ORF:atggagcaggtcgcggatttcgacacaatttatcaggcgatgata,caG,atA,tcG,gtA,gtT,ctA,tgC,ttT,gcC,ctA,ggA,atT,atT,gct,ggg,ggA,caa,aga,tga
Gene 9:
- RBS: tcgctgggggtcaaag
- ORF:atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgt,ttG,atg,gaG,acT,tcA,tca,tga
Gene 8:
- Promoter: aatctccgttgtactttgtttcgcgcttggtataatcgctgggggtc
- RBS: taatggaaacttcctc
- ORF:
atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggt tatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga
Notes
- I did not unstuff g7 RBS from g5 ORF and g3 promoter from g8 ORF because they were outside the scope of my renovation, which focused on the region between the former g8 promoter site and the beginning of the g8 ORF.
- I also added unique restriction sites in between parts the defined entire genes. I added a MfeI site between g7 and g9, a NcoI site between g9 and g8, and a NheI site after g3 promoter (which had overlapped with g8 ORF).
New Parts
- BBa_M31173: Project part, contains M13.1 genome from HpaI site to BamHI site
- BBa_M31339: Composite part, contains entire g8 gene (promoter + RBS + ORF)
- BBa_M31340: Composite part, contains entire g7 gene (RBS + ORF)
- BBa_M31341: Composite part, contains entire g9 gene (RBS + ORF)


