Etchevers:Notebook/STRA6 in eye development/2009/08/02

From OpenWetWare

Jump to: navigation, search
Genetics of human eye development Main project page
Previous entry      Next entry

More BLAST sequences homologous to a region chosen from human chr 1


Features in this part of subject sequence:
astrotactin 2 isoform a
astrotactin 2 isoform b Score = 1370 bits (1518), Expect = 0.0 Identities = 2607/3802 (68%), Gaps = 54/3802 (1%) Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484
||||| || || | ||||| |||||||| |||||| |||| ||| || | | ||||||
Sbjct 5358753 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 5358694

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544
||| || | ||||| | |||||||| ||||||| | | ||| | ||| |||| |
Sbjct 5358693 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 5358634

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604
|| || || |||| | || | ||||||||| || | | ||| | ||||| || ||
Sbjct 5358633 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 5358574 Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662 |||||| | |||||||| | ||||| |||| ||||| ||||||| |||||| || | Sbjct 5358573 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 5358516 Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722 | || | ||| | | || || ||| | ||||| || || | || || ||||| | Sbjct 5358515 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 5358456 Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780 |||| || |||||| ||||| | | ||||| ||||| || | | ||| | ||||| Sbjct 5358455 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 5358398 Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840 | || | | | |||||| ||||| |||||||||| ||||| ||||| ||| || | || Sbjct 5358397 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 5358338 Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900 ||||||| || ||||||| | |||| ||| || | | || | | || || | || Sbjct 5358337 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 5358278 Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960 | ||| || | ||| ||||||||||| | | || ||| ||| || |||||| || || Sbjct 5358277 AATGGATCTGACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTT 5358218 Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020 |||||||| || |||| ||||||||||||||||||| | || ||| || ||| Sbjct 5358217 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 5358158 Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079 || || || |||| | |||||| | || |||| | ||||| ||| |||| | | Sbjct 5358157 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 5358099 Query 3080 AACTAGAACTCAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAAC 3138 ||| ||| | || | | | || ||| || || || |||||||||||| Sbjct 5358098 GGCTAATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACGTGGAAACTGAAC 5358040 Query 3139 AACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTTC 3198 ||| || || ||||| || ||| | | | ||| ||| |||||| || || Sbjct 5358039 AACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTTT 5357980 Query 3199 TTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGCA 3258 || || ||||| || ||| |||||| |||| || || ||||| || | |||||| Sbjct 5357979 TTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGCA 5357920 Query 3259 GTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAAA 3318 | ||||||||| | ||||| ||| |||| ||||| ||| | ||| ||| | | Sbjct 5357919 TTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACAT 5357860 Query 3319 ATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAAA 3377 | | || | | ||| |||| |||||| |||||||| | || ||||| || ||| Sbjct 5357859 ACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAAG 5357800 Query 3378 AGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACACA 3437 || || ||| || | ||||||| ||| |||| | ||| | || || | || ||| Sbjct 5357799 AGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAAG 5357741 Query 3438 AAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAAT 3497 || ||| |||||| |||||| || | ||||| ||||| ||||| | || ||||| || Sbjct 5357740 AAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGAT 5357681 Query 3498 TGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCAA 3556 |||| ||| |||| ||||| | ||||| | | | || || | | ||| | || Sbjct 5357680 AGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAAA 5357622 Query 3557 TAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAGA 3616 | | ||| ||| || || || || || || |||| |||||| |||| ||||||||| Sbjct 5357621 TCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAGA 5357563 Query 3617 GAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATTC 3676 | ||||||| || ||| ||| ||||| ||||| || || |||||||| ||||| Sbjct 5357562 TCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATTT 5357503 Query 3677 CTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACCA 3736 ||||||| |||| | |||| | || ||||| ||||||| ||| || || || Sbjct 5357502 CTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCCC 5357443 Query 3737 ATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGGA 3796 ||| | ||||| | ||| | || ||||| | ||| ||||||| || |||||| Sbjct 5357442 ATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGGA 5357383 Query 3797 CCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCTT 3856 ||||| ||||| | || || ||||| |||| | ||| || || || ||| | || Sbjct 5357382 CCAGACGGATTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCTG 5357323 Query 3857 CTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGCC 3916 | ||||| || || |||||| ||| || || || || |||||||||||||| ||| Sbjct 5357322 CACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGCC 5357263 Query 3917 AGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACCA 3976 | || | ||||||||| || ||| | ||| ||||||| | |||||| || |||||| Sbjct 5357262 ACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACCA 5357203 Query 3977 ATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCAG 4036 || || | |||||||| || |||||||| || ||||||| || || || ||||||| Sbjct 5357202 ATTTCTCTTATGAACATCGATGCAAAAATTCTTAATAAAATTCTCGCTAACCGAATCCAA 5357143 Query 4037 CAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGGC 4096 | ||||| ||| | ||||| | ||| ||||| || || || || |||||||| || Sbjct 5357142 GAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGGA 5357083 Query 4097 TGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAAA 4156 ||||| |||||||| ||||| || ||||||||||| ||| ||||| | |||||||||| Sbjct 5357082 TGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAAA 5357023 Query 4157 AACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTTC 4216 ||||||||||| ||||| |||||||||||||||| |||||||| || ||||| || ||| Sbjct 5357022 AACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATTC 5356963 Query 4217 ATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGCT 4276 ||| ||||| |||| | | || ||| ||| | || || | || || |||| ||| Sbjct 5356962 ATGATAAAAGCTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGCA 5356903 Query 4277 ATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTCT 4336 ||||| |||||| |||||| |||| | | ||||| | || ||||||||| || | Sbjct 5356902 ATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCCA 5356843 Query 4337 TTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTTG 4396 | ||| | || || ||||| || ||||| || || || ||| ||||||||||| | Sbjct 5356842 CTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACTT 5356783 Query 4397 GAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAAA 4456 ||||| | ||||| |||||| | || | ||||| || ||||| || ||| | |||||| Sbjct 5356782 GAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAAA 5356723 Query 4457 GAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCATT 4516 |||||||||||| | || || |||||||| || ||||| |||||| || |||| | Sbjct 5356722 GAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAAA 5356663 Query 4517 GTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAAA 4576 || || | | ||||| || ||||||| || |||| | |||| | ||||| ||| Sbjct 5356662 AATTCCACCAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAAA 5356603 Query 4577 ATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCAA 4636 || || | | || ||| || | | ||||| || || | ||| | |||| || Sbjct 5356602 ATTAACTCAAACAAGTCAATGGCCCTTCTCTACACAAAGAATAAACAGGCTGAGAAAGAA 5356543 Query 4637 ATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCCA 4695 || | || ||| ||| ||| |||| || |||| | |||||||| || || | Sbjct 5356542 ATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGAC 5356484 Query 4696 ACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAAT 4755 || || | ||| ||||| | || | | | |||| ||| | ||| || ||||| Sbjct 5356483 TCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAAT 5356424 Query 4756 AAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATAT 4815 ||||| ||| | | |||||| | | |||||||||||| | || || | ||| || Sbjct 5356423 TAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACAT 5356364 Query 4816 CGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGCT 4875 || |||||||| || | | || | ||| |||||||||||||| |||||||| || | Sbjct 5356363 TGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAAT 5356304 Query 4876 ACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAAA 4935 |||| ||||||| ||| | ||| | | | || || ||||| ||||| | || Sbjct 5356303 TCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACAA 5356244 Query 4936 GAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCACA 4993 | | | || || || | | || | | |||||||| |||| || ||||| Sbjct 5356243 AAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCACC 5356186 Query 4994 CTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTAC 5053 | |||||| | || || ||||||| || | || | ||||| |||||||||||||| Sbjct 5356185 ATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTAT 5356126 Query 5054 CAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATATC 5113 | ||||| | | || |||||||| |||| | | ||||||| | || || | | Sbjct 5356125 AGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACACC 5356066 Query 5114 TACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCTA 5173 || | ||||||| ||||| | ||||| || || ||| || || | | Sbjct 5356065 TATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCATT 5356006 Query 5174 TTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATCC 5232 || || || ||||||||| | |||||| | | || |||||||| || | | ||||| Sbjct 5356005 TTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATTGATCC 5355947 Query 5233 CTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGACC 5292 | | | | |||| ||| || |||| || | ||||| || || | || | | ||| Sbjct 5355946 ATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAACC 5355887 Query 5293 TAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGGG 5352 | || | ||| |||| || || || || | | | || | || || |||| || Sbjct 5355886 AGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAGG 5355827 Query 5353 CAAGGACTTCATGTCTAAAACACCAAAAGCAATGGC---AAC---AAAAGACAAAATTGA 5406 | | ||| || |||| || ||||||||| || || | | |||||| Sbjct 5355826 GGAAAAATTCCTG-----AACA-GAACAGCAATGGCTTGTACTGTAAGATCGAGAATTGA 5355773 Query 5407 CAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAG 5465 ||||||||| ||||| ||||| | || ||||||| |||||||| ||| | || ||| Sbjct 5355772 CAAATGGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA- 5355714 Query 5466 TGAACAGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGG 5523 || || | ||| ||| | ||||| | || ||| | | |||| ||| || | || Sbjct 5355713 CAAAAAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGG 5355656 Query 5524 GCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCC 5583 |||||||||| || || || |||||||| | | || | |||| |||| ||||| Sbjct 5355655 ACTAATATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCC 5355596 Query 5584 CATCAAAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGC 5640 | | ||||| |||| || |||||| | | |||||| | ||| || ||| Sbjct 5355595 CCTTAAAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG- 5355538 Query 5641 AGCCAACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAA 5700 || | | ||| |||||||||| ||| |||| | |||||| |||||||||||||| Sbjct 5355537 -GCAGAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAA 5355479 Query 5701 AACCACAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAA 5760 ||| || |||||| ||| ||||||||||| |||||||| | || ||||| ||||| | Sbjct 5355478 AACAACCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGA 5355419 Query 5761 CAACAGGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTG 5820 || ||| |||||| ||||||||||||||| ||||||| | | || ||||||||||| || Sbjct 5355418 CAGCAGATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTG 5355359 Query 5821 TAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGA 5880 | || || |||||| | ||||| ||||| ||||| |||||||| | | || | | Sbjct 5355358 CAGGCTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGT 5355299 Query 5881 AATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATG 5940 | |||| || ||||| || || | ||||| ||||| ||| | || | | Sbjct 5355298 ACTACCGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAA 5355243 Query 5941 CTGCT-ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGA 5999 ||| | | || ||||||||| | |||||| || || || ||||| | |||||| | | Sbjct 5355242 CTGGTAAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAA 5355183 Query 6000 CTTGGAACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATAT 6059 ||||| |||||| ||| | ||| || ||||| ||||||||||| |||| | Sbjct 5355182 ACTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCT 5355123 Query 6060 ACACCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACAT 6119 |||| ||||| ||||| |||| || ||||| |||| || ||| || ||| | || Sbjct 5355122 ACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAAT 5355063 Query 6120 GGATGAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACC 6179 ||||| | |||| | |||||| || ||| | || | ||| ||||| | | |||| Sbjct 5355062 GGATGGACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACA 5355003 Query 6180 GCATATTCTCACTCATAGGTGG 6201 || | |||||| ||| |||| Sbjct 5355002 ATATGTACTCACTGATAAGTGG 5354981 Features flanking this part of subject sequence: 1016884 bp at 5' side: tripartite motif protein 32 192001 bp at 3' side: toll-like receptor 4 Score = 1370 bits (1518), Expect = 0.0 Identities = 2604/3797 (68%), Gaps = 44/3797 (1%) Strand=Plus/Minus Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484 ||||| || || | ||||| |||||||| |||||| |||| ||| || | | |||||| Sbjct 5925480 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 5925421 Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544 ||| || | ||||| | |||||||| ||||||| | | ||| | ||| |||| | Sbjct 5925420 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 5925361 Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604 || || || |||| | || | ||||||||| || | | ||| | ||||| || || Sbjct 5925360 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 5925301 Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662 |||||| | |||||||| | ||||| |||| ||||| ||||||| |||||| || | Sbjct 5925300 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 5925243 Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722 | || | ||| | | || || ||| | ||||| || || | || || ||||| | Sbjct 5925242 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 5925183 Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780 |||| || |||||| ||||| | | ||||| ||||| || | | ||| | ||||| Sbjct 5925182 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 5925125 Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840 | || | | | |||||| ||||| |||||||||| ||||| ||||| ||| || | || Sbjct 5925124 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 5925065 Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900 ||||||| || ||||||| | |||| ||| || | | || | | || || | || Sbjct 5925064 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 5925005 Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960 | ||| || | ||| ||||||||||| | |||| ||| ||| || |||||| || || Sbjct 5925004 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 5924945 Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020 |||||||| || |||| ||||||||||||||||||| | || ||| || ||| Sbjct 5924944 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAAACAGGCCT 5924885 Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079 || || || |||| | |||||| | || |||| | ||||| ||| |||| | | Sbjct 5924884 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 5924826 Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137 || || || || | || | | | || ||| || || |||||||||||||| Sbjct 5924825 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 5924768 Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197 |||| || || ||||| || ||| | | | ||| ||| |||||| || || Sbjct 5924767 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 5924708 Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257 || || ||||| || ||| |||||| |||| || || ||||| || | ||||| Sbjct 5924707 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 5924648 Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317 | | ||||||||| | ||||| ||| |||| ||||| ||| | ||| ||| | | Sbjct 5924647 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 5924588 Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376 | | || | | ||| |||| |||||| |||||||| | || ||||| || ||| Sbjct 5924587 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 5924528 Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436 || || ||| || | ||||||| ||| |||| | ||| | || || | || ||| Sbjct 5924527 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 5924469 Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496 || ||| |||||| |||||| || | ||||| ||||| ||||| | || ||||| | Sbjct 5924468 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 5924409 Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555 | |||| ||| |||| ||||| | ||||| | | | || || | | ||| | | Sbjct 5924408 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 5924350 Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615 || | ||| ||| || || || || || || |||| |||||| |||| |||||||| Sbjct 5924349 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 5924291 Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675 | | ||||||| || ||| ||| ||||| ||||| || || |||||||| ||||| Sbjct 5924290 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 5924231 Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735 ||||||| |||| | |||| | || ||||| ||||||| ||| || || || Sbjct 5924230 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 5924171 Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795 ||| | ||||| | ||| | || ||||| | ||| ||||||| || ||||| Sbjct 5924170 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 5924111 Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855 |||||| || || | || || ||||| |||| | ||| || || || ||| | || Sbjct 5924110 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 5924051 Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915 | ||||| || || |||||| ||| || || || || |||||||||||||| || Sbjct 5924050 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 5923991 Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975 || || | ||||||||| || ||| | ||| ||||||| | |||||| || ||||| Sbjct 5923990 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 5923931 Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035 ||| || | |||||||| || ||||||||||| ||||||| || || || ||||||| Sbjct 5923930 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 5923871 Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095 | ||||| ||| | ||||| | ||| ||||| || || || || |||||||| || Sbjct 5923870 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 5923811 Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155 ||||| |||||||| ||||| || ||||||||||| ||| ||||| | ||||||||| Sbjct 5923810 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 5923751 Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215 |||||||||||| ||||| |||||||||||||||| |||||||| || ||||| || || Sbjct 5923750 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 5923691 Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275 |||| ||||| ||| | | || ||| ||| | || || | || || |||| ||| Sbjct 5923690 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 5923631 Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335 ||||| |||||| |||||| |||| | | ||||| | || ||||||||| || | Sbjct 5923630 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 5923571 Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395 | ||| | || || ||||| || ||||| || || || ||| ||||||||||| | Sbjct 5923570 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 5923511 Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455 ||||| | ||||| |||||| | || | ||||| || ||||| || ||| | ||||| Sbjct 5923510 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 5923451 Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515 ||||||||||||| | || || |||||||| || ||||| |||||| || |||| | Sbjct 5923450 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 5923391 Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575 || | | | ||||| || |||||| || |||| | |||| | ||||| || Sbjct 5923390 AAATTCCAACAGAGAACTCCTAAACTTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 5923331 Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635 ||| || | | || ||| || || | ||||| || || | ||| | |||| | Sbjct 5923330 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 5923271 Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694 ||| | || ||| ||| ||| |||| || |||| | |||||||| || || | Sbjct 5923270 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 5923212 Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754 || || | ||| ||||| | || | | | |||| ||| | ||| || |||| Sbjct 5923211 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 5923152 Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814 | ||||| ||| | | |||||| | | |||||||||||| | || || | ||| | Sbjct 5923151 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 5923092 Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874 | || |||||||| || | | || | ||| |||||||||||||| |||||||| || Sbjct 5923091 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 5923032 Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934 | |||| ||||||| ||| | ||| | | | || || ||||| ||||| | | Sbjct 5923031 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 5922972 Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992 | | | | || || || | | || | | |||||||| |||| || ||||| Sbjct 5922971 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 5922914 Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052 | |||||| | || || ||||||| || | || | ||||| |||||||||||||| Sbjct 5922913 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 5922854 Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112 | ||||| | | || |||||||| |||| | | ||||||| | || || | Sbjct 5922853 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 5922794 Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172 ||| | ||||||| ||||| | ||||| || || ||| || || | | Sbjct 5922793 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 5922734 Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231 || || || ||||||||| | |||||| | | || |||||||| || | | |||| Sbjct 5922733 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 5922675 Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291 | | | | | |||| ||| || |||| || | ||||| || || | || | | || Sbjct 5922674 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 5922615 Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351 | | || | ||| |||| || || || || | | | || | || || |||| | Sbjct 5922614 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 5922555 Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411 | | | ||| || | |||| ||| || || || | | ||||||||||| Sbjct 5922554 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 5922495 Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470 |||| ||||| ||||| | || ||||||| |||||||| ||| | || ||| || Sbjct 5922494 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 5922436 Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528 || | ||| ||| | ||||| | || ||| | | |||| ||| || | || |||| Sbjct 5922435 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 5922378 Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588 |||||| || || || |||||||| | | || | |||| |||| |||||| | | Sbjct 5922377 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 5922318 Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645 |||| |||| || |||||| | | |||||| | ||| || ||| || Sbjct 5922317 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 5922261 Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705 | | ||| |||||||||| ||| |||| | |||||| ||||||||||||||||| | Sbjct 5922260 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 5922201 Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765 | |||||| ||| ||||||||||| |||||||| | || ||||| ||||| ||| || Sbjct 5922200 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 5922141 Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825 | |||||| ||||||||||||||| ||||||| | | || ||||||||||| || | | Sbjct 5922140 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 5922081 Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885 | || |||||| | ||||| ||||| ||||| |||||||| | | || | | | ||| Sbjct 5922080 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 5922021 Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945 | || ||||| || || | ||||| ||||| ||| | || | | ||| | Sbjct 5922020 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 5921965 Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004 | || ||||||||| | |||||| || || || ||||| | |||||| | | ||| Sbjct 5921964 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 5921905 Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064 || |||||| ||| | ||| || ||||| ||||||||||| |||| ||||| Sbjct 5921904 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 5921845 Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124 ||||| ||||| |||| || ||||| |||| || ||| || ||| | ||||||| Sbjct 5921844 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 5921785 Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184 | |||| | |||||| || ||| | || | ||| ||||| | | |||| || Sbjct 5921784 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 5921725 Query 6185 TTCTCACTCATAGGTGG 6201 | |||||| ||| |||| Sbjct 5921724 TACTCACTGATAAGTGG 5921708 Features flanking this part of subject sequence: 641758 bp at 5' side: hypothetical protein 173772 bp at 3' side: hypothetical protein LOC66928 Score = 1370 bits (1518), Expect = 0.0 Identities = 2605/3797 (68%), Gaps = 45/3797 (1%) Strand=Plus/Plus Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484 ||||| || || | ||||| |||||||| |||||| |||| ||| || | | |||||| Sbjct 14374681 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 14374740 Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544 ||| || | ||||| | |||||||| ||||||| | | ||| | ||| |||| | Sbjct 14374741 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 14374800 Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604 || || || |||| | || | ||||||||| || | | ||| | ||||| || || Sbjct 14374801 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 14374860 Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662 |||||| | |||||||| | ||||| |||| ||||| ||||||| |||||| || | Sbjct 14374861 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 14374918 Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722 | || | ||| | | || || ||| | ||||| || || | || || ||||| | Sbjct 14374919 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 14374978 Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780 |||| || |||||| ||||| | | ||||| ||||| || | | ||| | ||||| Sbjct 14374979 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 14375036 Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840 | || | | | |||||| ||||| |||||||||| ||||| ||||| ||| || | || Sbjct 14375037 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 14375096 Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900 ||||||| || ||||||| | |||| ||| || | | || | | || || | || Sbjct 14375097 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 14375156 Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960 | ||| || | ||| ||||||||||| | |||| ||| ||| || |||||| || || Sbjct 14375157 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 14375216 Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020 |||||||| || |||| ||||||||||||||||||| | || ||| || ||| Sbjct 14375217 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 14375276 Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079 || || || |||| | |||||| | || |||| | ||||| ||| |||| | | Sbjct 14375277 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 14375335 Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137 || || || || | || | | | || ||| || || |||||||||||||| Sbjct 14375336 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 14375393 Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197 |||| || || ||||| || ||| | | | ||| ||| | || ||||| || Sbjct 14375394 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAAAATTAAAGACTTT 14375453 Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257 || || ||||| || ||| |||||| |||| || || ||||| || | ||||| Sbjct 14375454 -TTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 14375512 Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317 | | ||||||||| | ||||| ||| |||| ||||| ||| | ||| ||| | | Sbjct 14375513 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 14375572 Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376 | | || | | ||| |||| |||||| |||||||| | || ||||| || ||| Sbjct 14375573 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 14375632 Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436 || || ||| || | ||||||| ||| |||| | ||| | || || | || ||| Sbjct 14375633 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 14375691 Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496 || ||| |||||| |||||| || | ||||| ||||| ||||| | || ||||| | Sbjct 14375692 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 14375751 Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555 | |||| ||| |||| ||||| | ||||| | | | || || | | ||| | | Sbjct 14375752 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 14375810 Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615 || | ||| ||| || || || || || || |||| |||||| |||| |||||||| Sbjct 14375811 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 14375869 Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675 | | ||||||| || ||| ||| ||||| ||||| || || |||||||| ||||| Sbjct 14375870 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 14375929 Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735 ||||||| |||| | |||| | || ||||| ||||||| ||| || || || Sbjct 14375930 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 14375989 Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795 ||| | ||||| | ||| | || ||||| | ||| ||||||| || ||||| Sbjct 14375990 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 14376049 Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855 |||||| || || | || || ||||| |||| | ||| || || || ||| | || Sbjct 14376050 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 14376109 Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915 | ||||| || || |||||| ||| || || || || |||||||||||||| || Sbjct 14376110 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 14376169 Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975 || || | ||||||||| || ||| | ||| ||||||| | |||||| || ||||| Sbjct 14376170 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 14376229 Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035 ||| || | |||||||| || ||||||||||| ||||||| || || || ||||||| Sbjct 14376230 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 14376289 Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095 | ||||| ||| | ||||| | ||| ||||| || || || || |||||||| || Sbjct 14376290 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 14376349 Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155 ||||| |||||||| ||||| || ||||||||||| ||| ||||| | ||||||||| Sbjct 14376350 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 14376409 Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215 |||||||||||| ||||| |||||||||||||||| |||||||| || ||||| || || Sbjct 14376410 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 14376469 Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275 |||| ||||| ||| | | || ||| ||| | || || | || || |||| ||| Sbjct 14376470 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 14376529 Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335 ||||| |||||| |||||| |||| | | ||||| | || ||||||||| || | Sbjct 14376530 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 14376589 Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395 | ||| | || || ||||| || ||||| || || || ||| ||||||||||| | Sbjct 14376590 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 14376649 Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455 ||||| | ||||| |||||| | || | ||||| || ||||| || ||| | ||||| Sbjct 14376650 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 14376709 Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515 ||||||||||||| | || || |||||||| || ||||| |||||| || |||| | Sbjct 14376710 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 14376769 Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575 || | | | ||||| || ||||||| || |||| | |||| | ||||| || Sbjct 14376770 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 14376829 Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635 ||| || | | || ||| || || | ||||| || || | ||| | |||| | Sbjct 14376830 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 14376889 Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694 ||| | || ||| ||| ||| |||| || |||| | |||||||| || || | Sbjct 14376890 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 14376948 Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754 || || | ||| ||||| | || | | | |||| ||| | ||| || |||| Sbjct 14376949 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 14377008 Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814 | ||||| ||| | | |||||| | | |||||||||||| | || || | ||| | Sbjct 14377009 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 14377068 Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874 | || |||||||| || | | || | ||| |||||||||||||| |||||||| || Sbjct 14377069 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 14377128 Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934 | |||| ||||||| ||| | ||| | | | || || ||||| ||||| | | Sbjct 14377129 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 14377188 Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992 | | | | || || || | | || | | |||||||| |||| || ||||| Sbjct 14377189 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 14377246 Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052 | |||||| | || || ||||||| || | || | ||||| |||||||||||||| Sbjct 14377247 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 14377306 Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112 | ||||| | | || |||||||| |||| | | ||||||| | || || | Sbjct 14377307 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 14377366 Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172 ||| | ||||||| ||||| | ||||| || || ||| || || | | Sbjct 14377367 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 14377426 Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231 || || || ||||||||| | |||||| | | || |||||||| || | | |||| Sbjct 14377427 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 14377485 Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291 | | | | | |||| ||| || |||| || | ||||| || || | || | | || Sbjct 14377486 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 14377545 Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351 | | || | ||| |||| || || || || | | | || | || || |||| | Sbjct 14377546 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 14377605 Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411 | | | ||| || | |||| ||| || || || | | ||||||||||| Sbjct 14377606 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 14377665 Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470 |||| ||||| ||||| | || ||||||| |||||||| ||| | || ||| || Sbjct 14377666 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 14377724 Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528 || | ||| ||| | ||||| | || ||| | | |||| ||| || | || |||| Sbjct 14377725 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 14377782 Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588 |||||| || || || |||||||| | | || | |||| |||| |||||| | | Sbjct 14377783 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 14377842 Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645 |||| |||| || |||||| | | |||||| | ||| || ||| || Sbjct 14377843 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 14377899 Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705 | | ||| |||||||||| ||| |||| | |||||| ||||||||||||||||| | Sbjct 14377900 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 14377959 Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765 | |||||| ||| ||||||||||| |||||||| | || ||||| ||||| ||| || Sbjct 14377960 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 14378019 Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825 | |||||| ||||||||||||||| ||||||| | | || ||||||||||| || | | Sbjct 14378020 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 14378079 Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885 | || |||||| | ||||| ||||| ||||| |||||||| | | || | | | ||| Sbjct 14378080 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 14378139 Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945 | || ||||| || || | ||||| ||||| ||| | || | | ||| | Sbjct 14378140 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 14378195 Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004 | || ||||||||| | |||||| || || || ||||| | |||||| | | ||| Sbjct 14378196 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 14378255 Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064 || |||||| ||| | ||| || ||||| ||||||||||| |||| ||||| Sbjct 14378256 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 14378315 Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124 ||||| ||||| |||| || ||||| |||| || ||| || ||| | ||||||| Sbjct 14378316 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 14378375 Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184 | |||| | |||||| || ||| | || | ||| ||||| | | |||| || Sbjct 14378376 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 14378435 Query 6185 TTCTCACTCATAGGTGG 6201 | |||||| ||| |||| Sbjct 14378436 TACTCACTGATAAGTGG 14378452 Features flanking this part of subject sequence: 647409 bp at 5' side: hypothetical protein LOC66928 15526 bp at 3' side: protein tyrosine phosphatase, receptor type, D isoform B Score = 1370 bits (1518), Expect = 0.0 Identities = 2604/3797 (68%), Gaps = 44/3797 (1%) Strand=Plus/Minus Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484 ||||| || || | ||||| |||||||| |||||| |||| ||| || | | |||||| Sbjct 15203951 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 15203892 Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544 ||| || | ||||| | |||||||| ||||||| | | ||| | ||| |||| | Sbjct 15203891 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 15203832 Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604 || || || |||| | || | ||||||||| || | | ||| | ||||| || || Sbjct 15203831 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 15203772 Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662 |||||| | |||||||| | ||||| |||| ||||| ||||||| |||||| || | Sbjct 15203771 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 15203714 Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722 | || | ||| | | || || ||| | ||||| || || | || || ||||| | Sbjct 15203713 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 15203654 Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780 |||| || |||||| ||||| | | ||||| ||||| || | | ||| | ||||| Sbjct 15203653 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 15203596 Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840 | || | | | |||||| ||||| |||||||||| ||||| ||||| ||| || | || Sbjct 15203595 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 15203536 Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900 ||||||| || ||||||| | |||| ||| || | | || | | || || | || Sbjct 15203535 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 15203476 Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960 | ||| || | ||| ||||||||||| | |||| ||| ||| || |||||| || || Sbjct 15203475 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 15203416 Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020 |||||||| || |||| ||||||||||||||||||| | || ||| || ||| Sbjct 15203415 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 15203356 Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079 || || || |||| | |||||| | || |||| | ||||| ||| |||| | | Sbjct 15203355 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 15203297 Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137 || || || || | || | | | || ||| || || |||||||||||||| Sbjct 15203296 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 15203239 Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197 |||| || || ||||| || ||| | | | ||| ||| |||||| || || Sbjct 15203238 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 15203179 Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257 || || ||||| || ||| |||||| |||| || || ||||| || | ||||| Sbjct 15203178 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 15203119 Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317 | | ||||||||| | ||||| ||| |||| ||||| ||| | ||| ||| | | Sbjct 15203118 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 15203059 Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376 | | || | | ||| |||| |||||| |||||||| | || ||||| || ||| Sbjct 15203058 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 15202999 Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436 || || ||| || | ||||||| ||| |||| | ||| | || || | || ||| Sbjct 15202998 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 15202940 Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496 || ||| |||||| |||||| || | ||||| ||||| ||||| | || ||||| | Sbjct 15202939 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 15202880 Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555 | |||| ||| |||| ||||| | ||||| | | | || || | | ||| | | Sbjct 15202879 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 15202821 Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615 || | ||| ||| || || || || || || |||| |||||| |||| |||||||| Sbjct 15202820 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 15202762 Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675 | | ||||||| || ||| ||| ||||| ||||| || || |||||||| ||||| Sbjct 15202761 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 15202702 Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735 ||||||| |||| | |||| | || ||||| ||||||| ||| || || || Sbjct 15202701 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 15202642 Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795 ||| | ||||| | ||| | || ||||| | ||| ||||||| || ||||| Sbjct 15202641 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 15202582 Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855 |||||| || || | || || ||||| |||| | ||| || || || ||| | || Sbjct 15202581 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 15202522 Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915 | ||||| || || |||||| ||| || || || || |||||||||||||| || Sbjct 15202521 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 15202462 Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975 || || | ||||||||| || ||| | ||| ||||||| | |||||| || ||||| Sbjct 15202461 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 15202402 Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035 ||| || | |||||||| || ||||||||||| ||||||| || || || ||||||| Sbjct 15202401 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 15202342 Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095 | ||||| ||| | ||||| | ||| ||||| || || || || |||||||| || Sbjct 15202341 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 15202282 Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155 ||||| |||||||| ||||| || ||||||||||| ||| ||||| | ||||||||| Sbjct 15202281 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 15202222 Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215 |||||||||||| ||||| |||||||||||||||| |||||||| || ||||| || || Sbjct 15202221 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 15202162 Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275 |||| ||||| ||| | | || ||| ||| | || || | || || |||| ||| Sbjct 15202161 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 15202102 Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335 ||||| |||||| |||||| |||| | | ||||| | || ||||||||| || | Sbjct 15202101 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 15202042 Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395 | ||| | || || ||||| || ||||| || || || ||| ||||||||||| | Sbjct 15202041 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 15201982 Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455 ||||| | ||||| |||||| | || | ||||| || ||||| || ||| | ||||| Sbjct 15201981 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 15201922 Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515 ||||||||||||| | || || |||||||| || ||||| |||||| || |||| | Sbjct 15201921 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 15201862 Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575 || | | | ||||| || ||||||| || |||| | |||| | ||||| || Sbjct 15201861 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 15201802 Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635 ||| || | | || ||| || || | ||||| || || | ||| | |||| | Sbjct 15201801 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 15201742 Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694 ||| | || ||| ||| ||| |||| || |||| | |||||||| || || | Sbjct 15201741 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 15201683 Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754 || || | ||| ||||| | || | | | |||| ||| | ||| || |||| Sbjct 15201682 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 15201623 Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814 | ||||| ||| | | |||||| | | |||||||||||| | || || | ||| | Sbjct 15201622 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 15201563 Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874 | || |||||||| || | | || | ||| |||||||||||||| |||||||| || Sbjct 15201562 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 15201503 Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934 | |||| ||||||| ||| | ||| | | | || || ||||| ||||| | | Sbjct 15201502 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 15201443 Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992 | | | | || || || | | || | | |||||||| |||| || ||||| Sbjct 15201442 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 15201385 Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052 | |||||| | || || ||||||| || | || | ||||| |||||||||||||| Sbjct 15201384 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 15201325 Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112 | ||||| | | || |||||||| |||| | | ||||||| | || || | Sbjct 15201324 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 15201265 Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172 ||| | ||||||| ||||| | ||||| || || ||| || || | | Sbjct 15201264 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 15201205 Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231 || || || ||||||||| | |||||| | | || |||||||| || | | |||| Sbjct 15201204 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 15201146 Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291 | | | | | |||| ||| || |||| || | ||||| || || || | | || Sbjct 15201145 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACCTCACATAAAAC 15201086 Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351 | | || | ||| |||| || || || || | | | || | || || |||| | Sbjct 15201085 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 15201026 Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411 | | | ||| || | |||| ||| || || || | | ||||||||||| Sbjct 15201025 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 15200966 Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470 |||| ||||| ||||| | || ||||||| |||||||| ||| | || ||| || Sbjct 15200965 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 15200907 Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528 || | ||| ||| | ||||| | || ||| | | |||| ||| || | || |||| Sbjct 15200906 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 15200849 Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588 |||||| || || || |||||||| | | || | |||| |||| |||||| | | Sbjct 15200848 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 15200789 Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645 |||| |||| || |||||| | | |||||| | ||| || ||| || Sbjct 15200788 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 15200732 Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705 | | ||| |||||||||| ||| |||| | |||||| ||||||||||||||||| | Sbjct 15200731 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 15200672 Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765 | |||||| ||| ||||||||||| |||||||| | || ||||| ||||| ||| || Sbjct 15200671 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 15200612 Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825 | |||||| ||||||||||||||| ||||||| | | || ||||||||||| || | | Sbjct 15200611 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 15200552 Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885 | || |||||| | ||||| ||||| ||||| |||||||| | | || | | | ||| Sbjct 15200551 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 15200492 Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945 | || ||||| || || | ||||| ||||| ||| | || | | ||| | Sbjct 15200491 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 15200436 Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004 | || ||||||||| | |||||| || || || ||||| | |||||| | | ||| Sbjct 15200435 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 15200376 Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064 || |||||| ||| | ||| || ||||| ||||||||||| |||| ||||| Sbjct 15200375 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 15200316 Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124 ||||| ||||| |||| || ||||| |||| || ||| || ||| | ||||||| Sbjct 15200315 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 15200256 Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184 | |||| | |||||| || ||| | || | ||| ||||| | | |||| || Sbjct 15200255 GACCTGGAGAGCATCATCCTGAGTGAGTTAACACAATCACAAAGGAACTCACACAATATG 15200196 Query 6185 TTCTCACTCATAGGTGG 6201 | |||||| ||| |||| Sbjct 15200195 TACTCACTGATAAGTGG 15200179 Features flanking this part of subject sequence: 931606 bp at 5' side: protein tyrosine phosphatase, receptor type, D isoform A 856861 bp at 3' side: hypothetical protein Score = 1370 bits (1518), Expect = 0.0 Identities = 2604/3797 (68%), Gaps = 44/3797 (1%) Strand=Plus/Plus Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484 ||||| || || | ||||| |||||||| |||||| |||| ||| || | | |||||| Sbjct 16339407 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 16339466 Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544 ||| || | ||||| | |||||||| ||||||| | | ||| | ||| |||| | Sbjct 16339467 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 16339526 Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604 || || || |||| | || | ||||||||| || | | ||| | ||||| || || Sbjct 16339527 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 16339586 Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662 |||||| | |||||||| | ||||| |||| ||||| ||||||| |||||| || | Sbjct 16339587 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 16339644 Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722 | || | ||| | | || || ||| | ||||| || || | || || ||||| | Sbjct 16339645 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 16339704 Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780 |||| || |||||| ||||| | | ||||| ||||| || | | ||| | ||||| Sbjct 16339705 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 16339762 Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840 | || | | | |||||| ||||| |||||||||| ||||| ||||| ||| || | || Sbjct 16339763 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 16339822 Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900 ||||||| || ||||||| | |||| ||| || | | || | | || || | || Sbjct 16339823 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 16339882 Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960 | ||| |||| ||| ||||||||||| | | || ||| ||| || |||||| || || Sbjct 16339883 AATGGATCTAACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTT 16339942 Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020 |||||||| || |||| ||||||||||||||||||| | || ||| || ||| Sbjct 16339943 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 16340002 Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079 || || || |||| | |||||| | || |||| | ||||| ||| |||| | | Sbjct 16340003 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 16340061 Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137 || || || || | || | | | || ||| || || |||||||||||||| Sbjct 16340062 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 16340119 Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197 |||| || || ||||| || ||| | | | ||| ||| |||||| || || Sbjct 16340120 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 16340179 Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257 || || ||||| || ||| |||||| |||| || || ||||| || | ||||| Sbjct 16340180 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 16340239 Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317 | | ||||||||| | ||||| |||| |||| || || || | ||| ||| | | Sbjct 16340240 ATTTCTAAGAGGGAAACTCATAGCTCTGAGTGCCTCCATGAAGAAACGGGAGAGAGCACA 16340299 Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376 | | || | | ||| ||||| |||||| |||||||| | || ||||| || ||| Sbjct 16340300 TACTAGCAGCTTGACAACACAACTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 16340359 Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436 || || ||| || | ||||||| ||| |||| | ||| | || || | || ||| Sbjct 16340360 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 16340418 Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496 || ||| |||||| |||||| || | ||||| ||||| ||||| | || ||||| | Sbjct 16340419 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 16340478 Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555 | |||| ||| |||| ||||| | ||||| | | | || || | | ||| | | Sbjct 16340479 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 16340537 Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615 || | ||| ||| || || || || || || |||| |||||| |||| |||||||| Sbjct 16340538 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 16340596 Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675 | | ||||||| || ||| ||| ||||| ||||| || || |||||||| ||||| Sbjct 16340597 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 16340656 Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735 ||||||| |||| | |||| | || ||||| ||||||| ||| || || || Sbjct 16340657 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 16340716 Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795 ||| | ||||| | ||| | || ||||| | | ||||||| || ||||| Sbjct 16340717 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCTGAGCCAAAAAAAGCCCAGG 16340776 Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855 |||||| || || | || || ||||| |||| | ||| || || || ||| | || Sbjct 16340777 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 16340836 Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915 | ||||| || || |||||| ||| || || || || |||||||||||||| || Sbjct 16340837 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 16340896 Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975 || || | ||||||||| || ||| | ||| ||||||| | |||||| || ||||| Sbjct 16340897 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 16340956 Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035 ||| || | |||||||| || ||||||||||| ||||||| || || || ||||||| Sbjct 16340957 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 16341016 Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095 | ||||| ||| | ||||| | ||| ||||| || || || || |||||||| || Sbjct 16341017 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 16341076 Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155 ||||| |||||||| ||||| || ||||||||||| ||| ||||| | ||||||||| Sbjct 16341077 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 16341136 Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215 |||||||||||| ||||| |||||||||||||||| |||||||| || ||||| || || Sbjct 16341137 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 16341196 Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275 |||| ||||| ||| | | || ||| ||| | || || | || || |||| ||| Sbjct 16341197 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 16341256 Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335 ||||| |||||| |||||| |||| | | ||||| | || ||||||||| || | Sbjct 16341257 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 16341316 Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395 | ||| | || || ||||| || ||||| || || || ||| ||||||||||| | Sbjct 16341317 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 16341376 Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455 ||||| | ||||| |||||| | || | ||||| || ||||| || ||| | ||||| Sbjct 16341377 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 16341436 Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515 ||||||||||||| | || || |||||||| || ||||| |||||| || |||| | Sbjct 16341437 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 16341496 Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575 || || | | ||||| || ||||||| || |||| | |||| | ||||| || Sbjct 16341497 AAATTCTACCAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 16341556 Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635 ||| || | | || ||| || || | ||||| || || | ||| | |||| | Sbjct 16341557 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 16341616 Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694 ||| | || ||| ||| ||| |||| || |||| | |||||||| || || | Sbjct 16341617 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 16341675 Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754 || || | ||| ||||| | || | | | |||| ||| | ||| || |||| Sbjct 16341676 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 16341735 Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814 | ||||| ||| | | |||||| | | |||||||||||| | || || | ||| | Sbjct 16341736 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 16341795 Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874 | || |||||||| || | | || | ||| |||||||||||||| |||||||| || Sbjct 16341796 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 16341855 Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934 | |||| ||||||| ||| | ||| | | | || || ||||| ||||| | | Sbjct 16341856 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 16341915 Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992 | | | | || || || | | || | | |||||||| |||| || ||||| Sbjct 16341916 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 16341973 Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052 | |||||| | || || ||||||| || | || | ||||| |||||||||||||| Sbjct 16341974 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 16342033 Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112 | ||||| | | || |||||||| |||| | | ||||||| | || || | Sbjct 16342034 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 16342093 Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172 ||| | ||||||| ||||| | ||||| || || ||| || || | | Sbjct 16342094 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 16342153 Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231 || || || ||||||||| | |||||| | | || |||||||| || | | |||| Sbjct 16342154 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 16342212 Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291 | | | | | |||| ||| || |||| || | ||||| || || | || | | || Sbjct 16342213 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 16342272 Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351 | | || | ||| |||| || || || || | | | || | || || |||| | Sbjct 16342273 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 16342332 Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411 | | | ||| || | |||| ||| || || || | | ||||||||||| Sbjct 16342333 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 16342392 Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470 |||| ||||| ||||| | || ||||||| |||||||| ||| | || ||| || Sbjct 16342393 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 16342451 Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528 || | ||| ||| | ||||| | || ||| | | |||| ||| || | || |||| Sbjct 16342452 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 16342509 Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588 |||||| || || || |||||||| | | || | |||| |||| |||||| | | Sbjct 16342510 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 16342569 Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645 |||| |||| || |||||| | | |||||| | ||| || ||| || Sbjct 16342570 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 16342626 Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705 | | ||| |||||||||| ||| |||| | |||||| ||||||||||||||||| | Sbjct 16342627 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 16342686 Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765 | |||||| ||| ||||||||||| |||||||| | || ||||| ||||| ||| || Sbjct 16342687 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 16342746 Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825 | |||||| ||||||||||||||| ||||||| | | || ||||||||||| || | | Sbjct 16342747 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 16342806 Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885 | || |||||| | ||||| ||||| ||||| |||||||| | | || | | | ||| Sbjct 16342807 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 16342866 Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945 | || ||||| || || | ||||| ||||| ||| | || | | ||| | Sbjct 16342867 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 16342922 Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004 | || ||||||||| | |||||| || || || ||||| | |||||| | | ||| Sbjct 16342923 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 16342982 Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064 || |||||| ||| | ||| || ||||| ||||||||||| |||| ||||| Sbjct 16342983 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 16343042 Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124 ||||| ||||| |||| || ||||| |||| || ||| || ||| | ||||||| Sbjct 16343043 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 16343102 Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184 | |||| | |||||| || ||| | || | ||| ||||| | | |||| || Sbjct 16343103 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 16343162 Query 6185 TTCTCACTCATAGGTGG 6201 | |||||| ||| |||| Sbjct 16343163 TACTCACTGATAAGTGG 16343179 Features flanking this part of subject sequence: 42184 bp at 5' side: hypothetical protein 18552 bp at 3' side: hypothetical protein Score = 1370 bits (1518), Expect = 0.0 Identities = 2604/3797 (68%), Gaps = 44/3797 (1%) Strand=Plus/Plus Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484 ||||| || || | ||||| |||||||| |||||| |||| ||| || | | |||||| Sbjct 21318084 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 21318143 Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544 ||| || | ||||| | |||||||| ||||||| | | ||| | ||| |||| | Sbjct 21318144 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 21318203 Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604 || || || |||| | || | ||||||||| || | | ||| | ||||| || || Sbjct 21318204 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 21318263 Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662 |||||| | |||||||| | ||||| |||| ||||| ||||||| |||||| || | Sbjct 21318264 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 21318321 Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722 | || | ||| | | || || ||| | ||||| || || | || || ||||| | Sbjct 21318322 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 21318381 Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780 |||| || |||||| ||||| | | ||||| ||||| || | | ||| | ||||| Sbjct 21318382 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 21318439 Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840 | || | | | |||||| ||||| |||||||||| ||||| ||||| ||| || | || Sbjct 21318440 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 21318499 Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900 ||||||| || ||||||| | |||| ||| || | | || | | || || | || Sbjct 21318500 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 21318559 Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960 | ||| || | ||| ||||||||||| | |||| ||| ||| || |||||| || || Sbjct 21318560 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 21318619 Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020 |||||||| || |||| ||||||||||||||||||| | || ||| || ||| Sbjct 21318620 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 21318679 Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079 || || || |||| | |||||| | || |||| | ||||| ||| |||| | | Sbjct 21318680 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 21318738 Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137 || || || || | || | | | || ||| || || |||||||||||||| Sbjct 21318739 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 21318796 Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197 |||| || || ||||| || ||| | | | ||| ||| |||||| || || Sbjct 21318797 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 21318856 Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257 || || ||||| || ||| |||||| |||| || || ||||| || | ||||| Sbjct 21318857 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 21318916 Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317 | | ||||||||| | ||||| ||| |||| ||||| ||| | ||| ||| | | Sbjct 21318917 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 21318976 Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376 | | || | | ||| |||| |||||| |||||||| | || ||||| || ||| Sbjct 21318977 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 21319036 Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436 || || ||| || | ||||||| ||| |||| | ||| | || || | || ||| Sbjct 21319037 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 21319095 Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496 || ||| |||||| |||||| || | ||||| ||||| ||||| | || ||||| | Sbjct 21319096 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 21319155 Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555 | |||| ||| |||| ||||| | ||||| | | | || || | | ||| | | Sbjct 21319156 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 21319214 Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615 || | ||| ||| || || || || || || |||| |||||| |||| |||||||| Sbjct 21319215 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 21319273 Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675 | | ||||||| || ||| ||| ||||| ||||| || || |||||||| ||||| Sbjct 21319274 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 21319333 Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735 ||||||| |||| | |||| | || ||||| ||||||| ||| || || || Sbjct 21319334 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 21319393 Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795 ||| | ||||| | ||| | || ||||| | ||| ||||||| || ||||| Sbjct 21319394 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 21319453 Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855 |||||| || || | || || ||||| |||| | ||| || || || ||| | || Sbjct 21319454 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 21319513 Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915 | ||||| || || |||||| ||| || || || || |||||||||||||| || Sbjct 21319514 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 21319573 Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975 || || | ||||||||| || ||| | ||| ||||||| | |||||| || ||||| Sbjct 21319574 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 21319633 Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035 ||| || | |||||||| || ||||||||||| ||||||| || || || ||||||| Sbjct 21319634 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 21319693 Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095 | ||||| ||| | ||||| | ||| ||||| || || || || |||||||| || Sbjct 21319694 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 21319753 Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155 ||||| |||||||| ||||| || ||||||||||| ||| ||||| | ||||||||| Sbjct 21319754 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 21319813 Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215 |||||||||||| ||||| |||||||||||||||| |||||||| || ||||| || || Sbjct 21319814 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 21319873 Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275 |||| ||||| ||| | | || ||| ||| | || || | || || |||| ||| Sbjct 21319874 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 21319933 Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335 ||||| |||||| |||||| |||| | | ||||| | || ||||||||| || | Sbjct 21319934 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 21319993 Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395 | ||| | || || ||||| || ||||| || || || ||| ||||||||||| | Sbjct 21319994 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 21320053 Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455 ||||| | ||||| |||||| | || | ||||| || ||||| || ||| | ||||| Sbjct 21320054 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 21320113 Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515 ||||||||||||| | || || |||||||| || ||||| |||||| || |||| | Sbjct 21320114 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 21320173 Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575 || | | | ||||| || ||||||| || |||| | |||| | ||||| || Sbjct 21320174 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 21320233 Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635 ||| || | | || ||| || || | ||||| || || | ||| | |||| | Sbjct 21320234 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 21320293 Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694 ||| | || ||| ||| ||| |||| || |||| | |||||||| || || | Sbjct 21320294 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 21320352 Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754 || || | ||| ||||| | || | | | |||| ||| | ||| || |||| Sbjct 21320353 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 21320412 Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814 | ||||| ||| | | |||||| | | |||||||||||| | || || | ||| | Sbjct 21320413 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 21320472 Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874 | || |||||||| || | | || | ||| |||||||||||||| |||||||| || Sbjct 21320473 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 21320532 Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934 | |||| ||||||| ||| | ||| | | | || || ||||| ||||| | | Sbjct 21320533 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 21320592 Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992 | | | | || || || | | || | | |||||||| |||| || ||||| Sbjct 21320593 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 21320650 Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052 | |||||| | || || ||||||| || | || | ||||| |||||||||||||| Sbjct 21320651 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 21320710 Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112 | ||||| | | || |||||||| |||| | | ||||||| | || || | Sbjct 21320711 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 21320770 Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172 ||| | ||||||| ||||| | ||||| || || ||| || || | | Sbjct 21320771 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 21320830 Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231 || || || ||||||||| | |||||| | | || |||||||| || | | |||| Sbjct 21320831 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 21320889 Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291 | | | | | |||| ||| || |||| || | ||||| || || | || | | || Sbjct 21320890 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 21320949 Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351 | | || | ||| |||| || || || || | | | || | || || |||| | Sbjct 21320950 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 21321009 Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411 | | | ||| || | |||| ||| || || || | | ||||||||||| Sbjct 21321010 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 21321069 Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470 |||| ||||| ||||| | || ||||||| |||||||| ||| | || ||| || Sbjct 21321070 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 21321128 Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528 || | ||| ||| | ||||| | || ||| | | |||| ||| || | || |||| Sbjct 21321129 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 21321186 Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588 |||||| || || || |||||||| | | || | |||| |||| |||||| | | Sbjct 21321187 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 21321246 Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645 |||| |||| || |||||| | | |||||| | ||| || ||| || Sbjct 21321247 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 21321303 Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705 | | ||| |||||||||| ||| |||| | |||||| ||||||||||||||||| | Sbjct 21321304 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 21321363 Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765 | |||||| ||| ||||||||||| |||||||| | || ||||| ||||| ||| || Sbjct 21321364 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 21321423 Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825 | |||||| ||||||||||||||| ||||||| | | || ||||||||||| || | | Sbjct 21321424 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 21321483 Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885 | || |||||| | ||||| ||||| ||||| |||||||| | | || | | | ||| Sbjct 21321484 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 21321543 Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945 | || ||||| || || | || || ||||| ||| | || | | ||| | Sbjct 21321544 CGGAGGATCCAGCAATACCTCTCCTAGGCATATATCCAGAAGA----AGCCCCAACTGGT 21321599 Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004 | || ||||||||| | |||||| || || || ||||| | |||||| | | ||| Sbjct 21321600 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 21321659 Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064 || |||||| ||| | ||| || ||||| ||||||||||| |||| ||||| Sbjct 21321660 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 21321719 Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124 ||||| ||||| |||| || ||||| |||| || ||| || ||| | ||||||| Sbjct 21321720 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 21321779 Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184 | |||| | |||||| || ||| | || | ||| ||||| | | |||| || Sbjct 21321780 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 21321839 Query 6185 TTCTCACTCATAGGTGG 6201 | |||||| ||| |||| Sbjct 21321840 TACTCACTGATAAGTGG 21321856 Features in this part of subject sequence: hypothetical protein LOC230393 Score = 1370 bits (1518), Expect = 0.0 Identities = 2604/3797 (68%), Gaps = 44/3797 (1%) Strand=Plus/Plus Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484 ||||| || || | ||||| |||||||| |||||| |||| ||| || | | |||||| Sbjct 27637477 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 27637536 Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544 ||| || | ||||| | |||||||| ||||||| | | ||| | ||| |||| | Sbjct 27637537 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 27637596 Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604 || || || |||| | || | ||||||||| || | | ||| | ||||| || || Sbjct 27637597 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 27637656 Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662 |||||| | |||||||| | ||||| |||| ||||| ||||||| |||||| || | Sbjct 27637657 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 27637714 Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722 | || | ||| | | || || ||| | ||||| || || | || || ||||| | Sbjct 27637715 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 27637774 Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780 |||| || |||||| ||||| | | ||||| ||||| || | | ||| | ||||| Sbjct 27637775 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 27637832 Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840 | || | | | |||||| ||||| |||||||||| ||||| ||||| ||| || | || Sbjct 27637833 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 27637892 Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900 ||||||| || ||||||| | |||| ||| || | | || | | || || | || Sbjct 27637893 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 27637952 Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960 | ||| || | ||| ||||||||||| | ||| ||| ||| || |||||| || || Sbjct 27637953 AATGGATCTGACAGATATCTACAGAACATTTTTCCCTAAAACAAAAGGATATACCTTCTT 27638012 Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020 |||||||| || |||| ||||||||||||||||||| | || ||| || ||| Sbjct 27638013 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 27638072 Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079 || || || |||| | |||||| | || |||| | ||||| ||| |||| | | Sbjct 27638073 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 27638131 Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137 || || || || | || | | | || ||| || || |||||||||||||| Sbjct 27638132 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 27638189 Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197 |||| || || ||||| || ||| | | | ||| ||| |||||| || || Sbjct 27638190 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 27638249 Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257 || || ||||| || ||| |||||| |||| || || ||||| || | ||||| Sbjct 27638250 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 27638309 Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317 | | ||||||||| | ||||| ||| |||| ||||| ||| | ||| ||| | | Sbjct 27638310 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 27638369 Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376 | | || | | ||| |||| |||||| |||||||| | || ||||| || ||| Sbjct 27638370 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 27638429 Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436 || || ||| || | ||||||| ||| |||| | ||| | || || | || ||| Sbjct 27638430 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 27638488 Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496 || ||| |||||| |||||| || | ||||| ||||| ||||| | || ||||| | Sbjct 27638489 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 27638548 Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555 | |||| ||| |||| ||||| | ||||| | | | || || | | ||| | | Sbjct 27638549 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 27638607 Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615 || | ||| ||| || || || || || || |||| |||||| |||| |||||||| Sbjct 27638608 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 27638666 Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675 | | ||||||| || ||| ||| ||||| ||||| || || |||||||| ||||| Sbjct 27638667 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 27638726 Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735 ||||||| |||| | |||| | || ||||| ||||||| ||| || || || Sbjct 27638727 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 27638786 Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795 ||| | ||||| | ||| | || ||||| | ||| ||||||| || ||||| Sbjct 27638787 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 27638846 Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855 |||||| || || | || || ||||| |||| | ||| || || || ||| | || Sbjct 27638847 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 27638906 Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915 | ||||| || || |||||| ||| || || || || |||||||||||||| || Sbjct 27638907 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 27638966 Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975 || || | ||||||||| || ||| | ||| ||||||| | |||||| || ||||| Sbjct 27638967 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 27639026 Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035 ||| || | |||||||| || |||||||| || ||||||| || || || ||||||| Sbjct 27639027 AATTTCTCTTATGAACATCGATGCAAAAATTCTTAATAAAATTCTCGCTAACCGAATCCA 27639086 Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095 | ||||| ||| | ||||| | ||| ||||| || || || || |||||||| || Sbjct 27639087 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 27639146 Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155 ||||| |||||||| ||||| || ||||||||||| ||| ||||| | ||||||||| Sbjct 27639147 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 27639206 Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215 |||||||||||| ||||| |||||||||||||||| |||||||| || ||||| || || Sbjct 27639207 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 27639266 Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275 |||| ||||| ||| | | || ||| ||| | || || | || || |||| ||| Sbjct 27639267 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 27639326 Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335 ||||| |||||| |||||| |||| | | ||||| | || ||||||||| || | Sbjct 27639327 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 27639386 Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395 | ||| | || || ||||| || ||||| || || || ||| ||||||||||| | Sbjct 27639387 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 27639446 Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455 ||||| | ||||| |||||| | || | ||||| || ||||| || ||| | ||||| Sbjct 27639447 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 27639506 Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515 ||||||||||||| | || || |||||||| || ||||| |||||| || |||| | Sbjct 27639507 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 27639566 Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575 || | | | ||||| || ||||||| || |||| | |||| | ||||| || Sbjct 27639567 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 27639626 Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635 ||| || | | || ||| || || | ||||| || || | ||| | |||| | Sbjct 27639627 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 27639686 Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694 ||| | || ||| ||| ||| |||| || |||| | |||||||| || || | Sbjct 27639687 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 27639745 Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754 || || | ||| ||||| | || | | | |||| ||| | ||| || |||| Sbjct 27639746 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 27639805 Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814 | ||||| ||| | | |||||| | | |||||||||||| | || || | ||| | Sbjct 27639806 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 27639865 Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874 | || |||||||| || | | || | ||| |||||||||||||| |||||||| || Sbjct 27639866 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 27639925 Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934 | |||| ||||||| ||| | ||| | | | || || ||||| ||||| | | Sbjct 27639926 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 27639985 Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992 | | | | || || || | | || | | |||||||| |||| || ||||| Sbjct 27639986 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 27640043 Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052 | |||||| | || || ||||||| || | || | ||||| |||||||||||||| Sbjct 27640044 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 27640103 Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112 | ||||| | | || |||||||| |||| | | ||||||| | || || | Sbjct 27640104 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 27640163 Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172 ||| | ||||||| ||||| | ||||| || || ||| || || | | Sbjct 27640164 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 27640223 Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231 || || || ||||||||| | |||||| | | || |||||||| || | |||||| Sbjct 27640224 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATGGATC 27640282 Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291 | | | | | |||| ||| || |||| || | ||||| || || | || | | || Sbjct 27640283 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 27640342 Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351 | | || | ||| |||| || || || || | | | || | || || |||| | Sbjct 27640343 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 27640402 Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411 | | | ||| || | |||| ||| || || || | | ||||||||||| Sbjct 27640403 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 27640462 Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470 |||| ||||| ||||| | || ||||||| |||||||| ||| | || ||| || Sbjct 27640463 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 27640521 Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528 || | ||| ||| | ||||| | || ||| | | |||| ||| || | || |||| Sbjct 27640522 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 27640579 Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588 |||||| || || || |||||||| | | || | |||| |||| |||||| | | Sbjct 27640580 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 27640639 Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645 |||| |||| || |||||| | | |||||| | ||| || ||| || Sbjct 27640640 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 27640696 Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705 | | ||| |||||||||| ||| |||| | |||||| ||||||||||||||||| | Sbjct 27640697 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 27640756 Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765 | |||||| ||| ||||||||||| |||||||| | || ||||| ||||| ||| || Sbjct 27640757 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 27640816 Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825 | |||||| ||||||||||||||| ||||||| | | || ||||||||||| || | | Sbjct 27640817 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 27640876 Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885 | || |||||| | ||||| ||||| ||||| |||||||| | | || | | | ||| Sbjct 27640877 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 27640936 Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945 | || ||||| || || | ||||| ||||| ||| | || | | ||| | Sbjct 27640937 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 27640992 Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004 | || ||||||||| | |||||| || || || ||||| | |||||| | | ||| Sbjct 27640993 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 27641052 Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064 || |||||| ||| | ||| || ||||| ||||||||||| |||| ||||| Sbjct 27641053 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 27641112 Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124 ||||| ||||| |||| || ||||| |||| || ||| || ||| | ||||||| Sbjct 27641113 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 27641172 Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184 | |||| | |||||| || ||| | || | ||| ||||| | | |||| || Sbjct 27641173 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 27641232 Query 6185 TTCTCACTCATAGGTGG 6201 | |||||| ||| |||| Sbjct 27641233 TACTCACTGATAAGTGG 27641249 Features flanking this part of subject sequence: 400561 bp at 5' side: tenascin C 699609 bp at 3' side: pregnancy-associated plasma protein A Score = 1368 bits (1516), Expect = 0.0 Identities = 2606/3799 (68%), Gaps = 48/3799 (1%) Strand=Plus/Minus Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484 ||||| || || | ||||| |||||||| |||||| |||| ||| || | | |||||| Sbjct 3714582 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 3714523 Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544 ||| || | ||||| | |||||||| ||||||| | | ||| | ||| |||| | Sbjct 3714522 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 3714463 Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604 || || || |||| | || | ||||||||| || | | ||| | ||||| || || Sbjct 3714462 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 3714403 Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662 |||||| | |||||||| | ||||| |||| ||||| ||||||| |||||| || | Sbjct 3714402 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 3714345 Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722 | || | ||| | | || || ||| | ||||| || || | || || ||||| | Sbjct 3714344 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 3714285 Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780 |||| || |||||| ||||| | | ||||| ||||| || | | ||| | ||||| Sbjct 3714284 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 3714227 Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840 | || | | | |||||| ||||| |||||||||| ||||| ||||| ||| || | || Sbjct 3714226 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 3714167 Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900 ||||||| || ||||||| | |||| ||| || | | || | | || || | || Sbjct 3714166 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 3714107 Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960 | ||| || | ||| ||||||||||| | | || ||| ||| || |||||| || || Sbjct 3714106 AATGGATCTGACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTT 3714047 Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020 |||||||| || |||| ||||||||||||||||||| | || ||| || ||| Sbjct 3714046 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 3713987 Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079 || || ||| |||| | |||||| | || |||| | ||||| ||| |||| | | Sbjct 3713986 CAACAGATGCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 3713928 Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137 || || || || | || | | | || ||| || || |||||||||||||| Sbjct 3713927 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 3713870 Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197 |||| || || ||||| || ||| | | ||||| ||| |||||| || || Sbjct 3713869 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGAAATAAAGAAAGAAATTAAAGACTT 3713810 Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257 || || ||||| || ||| |||||| |||| || || ||||| || | ||||| Sbjct 3713809 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 3713750 Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317 | | ||||||||| | ||||| ||| |||| ||||| ||| | ||| ||| | | Sbjct 3713749 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 3713690 Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376 | | || | | ||| |||| |||||| |||||||| | || ||||| || ||| Sbjct 3713689 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 3713630 Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436 || || ||| || | ||||||| ||| |||| | ||| | || || | || ||| Sbjct 3713629 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 3713571 Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496 || ||| |||||| |||||| || | ||||| ||||| ||||| | || ||||| | Sbjct 3713570 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 3713511 Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555 | |||| ||| ||| ||||| | ||||| | | | || || | | ||| | | Sbjct 3713510 TAGATAAACCCTCAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 3713452 Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615 || | ||| ||| || || || || || || |||| |||||| |||| |||||||| Sbjct 3713451 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 3713393 Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675 | | ||||||| || ||| ||| ||||| ||||| || || |||||||| ||||| Sbjct 3713392 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 3713333 Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735 ||||||| |||| | |||| | || ||||| ||||||| ||| || || || Sbjct 3713332 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 3713273 Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795 ||| | ||||| | ||| | || ||||| | ||| ||||||| || ||||| Sbjct 3713272 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 3713213 Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855 |||||| | || | || || ||||| |||| | ||| || || || ||| | || Sbjct 3713212 ACCAGACAGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 3713153 Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915 | ||||| || || |||||| ||| || || || || |||||||||||||| || Sbjct 3713152 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 3713093 Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975 || || | ||||||||| || ||| | ||| ||||||| | |||||| || ||||| Sbjct 3713092 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 3713033 Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035 ||| || | |||||||| || ||||||||||| ||||||| || || || ||||||| Sbjct 3713032 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 3712973 Query 4036 GCAGCACATCAAAAAGC--TTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAA 4093 || |||| ||||| | ||||| | ||| ||||| || || || || |||||||| Sbjct 3712972 --AGAACATATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAG 3712915 Query 4094 GGCTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGAC 4153 || ||||| |||||||| ||||| || ||||||||||| ||| ||||| | ||||||| Sbjct 3712914 GGATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGAC 3712855 Query 4154 AAAAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCC 4213 |||||||||||||| ||||| |||||||||||||||| |||||||| || ||||| || Sbjct 3712854 AAAAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCA 3712795 Query 4214 TTCATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGA 4273 |||||| ||||| ||| | | || ||| ||| | || || | || || |||| | Sbjct 3712794 TTCATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAA 3712735 Query 4274 GCTATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTC 4333 || ||||| |||||| |||||| |||| | | ||||| | || |||||| || || Sbjct 3712734 GCAATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAACAATC 3712675 Query 4334 TCTTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTG 4393 | | ||| | || || ||||| || ||||| || || || ||| ||||||||||| Sbjct 3712674 CCACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTA 3712615 Query 4394 TTGGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGA 4453 | ||||| | ||||| |||||| | || | ||||| || ||||| || ||| | ||| Sbjct 3712614 CTTGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGA 3712555 Query 4454 AAAGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCC 4513 ||||||||||||||| | || || |||||||| || ||||| |||||| || |||| Sbjct 3712554 AAAGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCT 3712495 Query 4514 ATTGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATAC 4573 | || | | | ||||| || ||||||| || |||| | |||| | ||||| Sbjct 3712494 AAAAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATAT 3712435 Query 4574 AAAATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGC 4633 ||||| || | | || ||| || || | ||||| || || | ||| | |||| Sbjct 3712434 AAAATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAA 3712375 Query 4634 CAAATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAAT 4692 |||| | || ||| ||| ||| |||| || |||| | |||||||| || || | Sbjct 3712374 GAAATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGT 3712316 Query 4693 CCAACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGA 4752 || || | ||| ||||| | || | | | |||| |||| ||||| || || Sbjct 3712315 GACTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAATCTCTGAAGAAAGA 3712256 Query 4753 AATAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAA 4812 ||| ||||| ||| | | |||||| | | |||||||||||| | || || | ||| Sbjct 3712255 AATTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAA 3712196 Query 4813 TATCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAA 4872 || || |||||||| || | | || | ||| |||||||||||||| |||||||| || Sbjct 3712195 CATTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAA 3712136 Query 4873 GCTACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCA 4932 | |||| ||||||| ||| | ||| | | | || || ||||| ||||| | Sbjct 3712135 AATTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAA 3712076 Query 4933 AAAGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATC 4990 || | | | || || || | | || | | |||||||| |||| || ||| Sbjct 3712075 CAAAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATC 3712018 Query 4991 ACACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGG 5050 || | |||||| | || || ||||||| || | || | ||||| |||||||||||| Sbjct 3712017 ACCATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGG 3711958 Query 5051 TACCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCAT 5110 || | ||||| | | || |||||||| |||| | | ||||||| | || || Sbjct 3711957 TATAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACAC 3711898 Query 5111 ATCTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCC 5170 | ||| | ||||||| ||||| | ||||| || || ||| || || | Sbjct 3711897 ACCTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGC 3711838 Query 5171 CTATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGA 5229 | || || || ||||||||| | |||||| | | || |||||||| || | | || Sbjct 3711837 ATTTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGA 3711779 Query 5230 TCCCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAG 5289 ||| | | | | |||| ||| || |||| || | ||||| || || | || | | Sbjct 3711778 TCCATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGATCTTCACATAAA 3711719 Query 5290 ACCTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCAT 5349 ||| | || | ||| |||| || || || || | | | || | || || |||| Sbjct 3711718 ACCAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCAC 3711659 Query 5350 GGGCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAA 5409 || | | ||| || | |||| ||| || || || | | ||||||||| Sbjct 3711658 AGGGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAA 3711599 Query 5410 ATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGA 5468 |||||| ||||| ||||| | || ||||||| |||||||| ||| | || ||| | Sbjct 3711598 ATGGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAA 3711540 Query 5469 ACAGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCT 5526 | || | ||| ||| | ||||| | || ||| | | |||| ||| || | || || Sbjct 3711539 AAAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACT 3711482 Query 5527 AATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCAT 5586 |||||||| || || || |||||||| | | || | |||| |||| |||||| | Sbjct 3711481 AATATCCAACATATATAAAGAACTCAAGAAGGTGGACTTCAGAAAATCAAATAACCCCCT 3711422 Query 5587 CAAAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGC 5643 ||||| |||| || |||||| | | |||||| | ||| || ||| || Sbjct 3711421 TAAAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GC 3711365 Query 5644 CAACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAAC 5703 | | ||| |||||||||| ||| |||| | |||||| ||||||||||||||||| Sbjct 3711364 AGAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAAC 3711305 Query 5704 CACAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAA 5763 || |||||| ||| ||||||||||| |||||||| | || ||||| ||||| ||| Sbjct 3711304 AACCCTGAGATTCCACCTCACACCAGTCAGAATGGCTAAGATCAAAAATTCAGGTGACAG 3711245 Query 5764 CAGGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAA 5823 ||| |||||| ||||||||||||||| ||||||| | | || ||||||||||| || | Sbjct 3711244 CAGATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAG 3711185 Query 5824 ACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAAT 5883 || || |||||| | ||||| ||||| ||||| |||||||| | | || | | | | Sbjct 3711184 GCTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACT 3711125 Query 5884 ACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTG 5943 ||| || ||||| || || | ||||| ||||| ||| | || | | ||| Sbjct 3711124 ACCGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTG 3711069 Query 5944 CT-ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTT 6002 | | || ||||||||| | |||||| || || || ||||| | |||||| | | | Sbjct 3711068 GTAAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACT 3711009 Query 6003 GGAACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACA 6062 |||| |||||| ||| | ||| || ||||| ||||||||||| |||| |||| Sbjct 3711008 GGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACA 3710949 Query 6063 CCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGA 6122 | ||||| ||||| |||| || ||||| |||| || ||| || ||| | ||||| Sbjct 3710948 CAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGA 3710889 Query 6123 TGAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCA 6182 || | |||| |||||| || ||| | || | ||| ||||| | | |||| | Sbjct 3710888 TGGACCTGGAGGGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATA 3710829 Query 6183 TATTCTCACTCATAGGTGG 6201 | | |||||| ||| |||| Sbjct 3710828 TGTACTCACTGATAAGTGG 3710810

  • Heather 08:12, 1 August 2009 (EDT):


Personal tools