Haynes Lab:Notebook/Investigating Photo-Switchable Synthetic Nucleosomes/2012/11/26
Project name | Main project page Previous entry Next entry |
November 26, 2012Gibson assembly written by Dr. Haynes
The Gibson assembly method joins double stranded fragments that have overlapping matching ends. Matching ends (instead of BioBrick cut sites) are artificially added via PCR. To do Gibson assembly, we need primers that span 40 bp across junctions of the individual parts.
We will cut the vector with XbaI and SpeI so the ends will look like this: pSB1A3 left end: …tctggaattcgcggccgctt/ pSB1A3 right end: /ctagtagcggccgctgcagt…
1. pSB1A3 left end / H2B / LOV +His tag/ pSB1A3 right end …to get a circular plasmid.
2. pSB1A3 left end / LOV / H2B +His tag/ pSB1A3 right end
After PCR of each part, the two PCR products will be mixed with the X/S cut vector and subjected to isothermal assembly: http://openwetware.org/wiki/Haynes:Gibson_Assembly
|