IGEM:HKUSTers/Primers

From OpenWetWare

Jump to: navigation, search

EcoRI_T7P: GC GAA TTC TAATACGACTCACTATAGGG

4_XhoI:

7_followup_1:

7_followup_2:

19_new_up:

20_up:

21_up:


Primers
Number Name Sequence Tm Date

...

Personal tools