IGEM:Harvard/2006/Container Design 5/Oligos

From OpenWetWare

Jump to: navigation, search






Contents

(Pre)Working Stocks

Table of c5.0 Working Stocks

Aptamer Oligos (9/12)

  • Sequences actually ordered (ie. sequences that are long enough that we actually need them, and that we didn't already have in another order) are in italics.
  • Thus, BE CAREFUL when making pre-working stocks - read the notes next to each oligo and make sure ALL of the necessary oligos are included.
  • Excel document used to organize these is here.
c5.0.21 ' (outward-facing barrel oligos @ aptamers +aptamers) '
original, unmodified oligooligo #sequencenotes
oligo 7c5.0.21.1aATAAATC GTGTTGT TCCAGTT ttt ggttggtgtggttgg
oligo 7c5.0.21.1bTGGAACAAGAGTCCGTAAAGC (don't need to reorder - same as c5.0.8.1rb, so use that instead)
oligo 43c5.0.21.2aGCCGGAA GCAGGTC GACTCTA AGGGGGA ttt ggttggtgtggttgg
oligo 43c5.0.21.2bTGTGCTGCGGAAAC (don't need to reorder - same as c5.0.8.2rb, so use that instead)
oligo 65c5.0.21.3TCATTTT TTTACAA ACAATTC AAATGAA AAATCTA GATAAAA ttt ggttggtgtggttgg
oligo 75c5.0.21.4ATCAATA GATAAAA ATTTTTA GAACCCT CATATAT ATTAGCA ttt ggttggtgtggttgg
oligo 78c5.0.21.5aGGTATTA AATATCC CATCCTA ttt ggttggtgtggttgg
oligo 78c5.0.21.5bATTTACGAGCATGTCGAGCCA(don't need to reorder - same as c5.0.8.5rb, so use that instead)


c5.0.22 ' (inward-facing barrel oligos @ aptamers +aptamers) '
original, unmodified oligooligo #sequencenotes
oligo 33c5.0.22.1aGCCGCCA TTGATAT TCACAAA ttt ggttggtgtggttgg
oligo 33c5.0.22.1bCAAATAAATCCTCATCTGAAT (don't need to reorder - same as 5.0.9.1rb, so use that instead)
oligo 67c5.0.22.2aATTTACA TTTTGCG GGATCGT GAAGTTT CCATTAA ttt ggttggtgtggttgg
oligo 67c5.0.22.2bACGGGTA (too short - don't need to order)
oligo 89c5.0.22.3aTGGATAG CGATAAA AACCAAA ttt ggttggtgtggttgg
oligo 89c5.0.22.3bATAGCGAGAGGCTTACAACAT (don't need to reorder - same as 5.0.9.3rb, so use that instead)
oligo 95c5.0.22.4aAAAGAAA AATGAAT TTTCTGT TCACCAG TACAAAC ttt ggttggtgtggttgg
oligo 95c5.0.22.4bTACAACG(too short - don't need to order)
oligo 104c5.0.22.5aTCATTTG TTCTGCG ttt ggttggtgtggttgg
oligo 104c5.0.22.5bAACGAGTGGTCATTTTTGCGGACCAGAC(don't need to reorder - same as 5.0.9.5rb, so use that instead)

Revised Biotinylated c5.0.8 and c5.0.9 Oligos (8/25)


c5.0.8revised (outward-facing) ("a" and "b" denote the splitting of the original, unmodified oligos' sequences)
oligo 7c5.0.8.1raATAAATC GTGTTGT TCCAGTT -biotin
oligo 7c5.0.8.1rbTGGAACAAGAGTCCGTAAAGC
oligo 43c5.0.8.2raGCCGGAA GCAGGTC GACTCTA AGGGGGA -biotin
oligo 43c5.0.8.2rbTGTGCTGCGGAAAC
oligo 65c5.0.8.3rTCATTTT TTTACAA ACAATTC AAATGAA AAATCTA GATAAAA-biotin (don't need to order - same as c5.0.8.3)
oligo 75c5.0.8.4rATCAATA GATAAAA ATTTTTA GAACCCT CATATAT ATTAGCA-biotin (don't need to order - same as c5.0.8.4)
oligo 78c5.0.8.5raGGTATTA AATATCC CATCCTA -biotin
oligo 78c5.0.8.5rbATTTACGAGCATGTCGAGCCA
c5.0.9revised (inward-facing) ("a" and "b" denote the splitting of the original, unmodified oligos' sequences)
oligo 33c5.0.9.1raGCCGCCA TTGATAT TCACAAA -biotin
oligo 33c5.0.9.1rbCAAATAAATCCTCATCTGAAT
oligo 67c5.0.9.2raATTTACA TTTTGCG GGATCGT GAAGTTT CCATTAA -biotin
oligo 67c5.0.9.2rbACGGGTA (don't need to order)
oligo 89c5.0.9.3raTGGATAG CGATAAA AACCAAA -biotin
oligo 89c5.0.9.3rbATAGCGAGAGGCTTACAACAT
oligo 95c5.0.9.4raAAAGAAA AATGAAT TTTCTGT TCACCAG TACAAAC -biotin
oligo 95c5.0.9.4rbTACAACG (don't need to order)
oligo 104c5.0.9.5raTCATTTG TTCTGCG -biotin
oligo 104c5.0.9.5rbAACGAGTGGTCATTTTTGCGGACCAGAC

Attachment-Ligand Oligo Order (8/8)

c5.0.4o: barrel oligos @ outside aptamers +ligand-binding-site (includes "splits," divided into "a" and "b")
oligo 7c5.0.4.1oaATAAATCGTGTTGTTCCAGTTTTTTTTTTCCGCGGGCGCGCCCC
oligo 7c5.0.4.1obTGGAACAAGAGTCCGTAAAGC
oligo 43c5.0.4.2oaGCCGGAAGCAGGTCGACTCTAAGGGGGATTTTTTTTCCGCGGGCGCGCCCC
oligo 43c5.0.4.2obTGTGCTGCGGAAAC
oligo 65c5.0.4.3oaTCATTTTTTTACAAACAATTCAAATGAA
oligo 65c5.0.4.3obAAATCTAGATAAAATTTTTTTTCCGCGGGCGCGCCCC
oligo 75c5.0.4.4oaATCAATAGATAAAAATTTTTA
oligo 75c5.0.4.4obGAACCCTCATATATATTAGCATTTTTTTTCCGCGGGCGCGCCCC
oligo 78c5.0.4.5oaGGTATTAAATATCCCATCCTAATTTTTTTTTTTCCGCGGGCGCGCCCC
oligo 78c5.0.4.5obACGAGCATGTCGAGCCA
c5.0.5o: barrel oligos @ inside aptamers +ligand-binding-sites (includes "splits," divided into "a" and "b"
oligo 33c5.0.5.1oaGCCGCCATTGATATTCACAAATTTTTTTTCCGCGGGCGCGCCCC
oligo 33c5.0.5.1obCAAATAAATCCTCATCTGAAT
oligo 67c5.0.5.2oaATTTACATTTTGCGGGATCGTGAAGTTT
oligo 67c5.0.5.2obCCATTAATTTTTTTTCCGCGGGCGCGCCCC
oligo 89c5.0.5.3oaTGGATAGCGATAAAAACCAAATTTTTTTTCCGCGGGCGCGCCCC
oligo 89c5.0.5.3obATAGCGAGAGGCTTACAACAT
oligo 95c5.0.5.4oaAAAGAAAAATGAATTTTCTGTTCACCAG
oligo 95c5.0.5.4obTACAAACTTTTTTTTCCGCGGGCGCGCCCC
oligo 104c5.0.5.5oaTCATTTGTTCTGCGTTTTTTTTCCGCGGGCGCGCCCC
oligo 104c5.0.5.5obAACGAGTGGTCATTTTTGCGGACCAGAC

Latch Order (8/8)

c5.0.10 and 11: barrel latches (10) and the left-over "splits" of the latches (11)
oligo 30lac5.0.10.1GGATTAGCCCTCAGTTTTTTTTTTCCGGTGCAGAAGTTT
oligo 179lac5.0.10.2GTCCACGGAGAGAGTTTTTTTTTTTTTGGCACTCCTACAATT
oligo 139lac5.0.10.3TTTGAGTACCTACCATATCAATTTTGACGATAGGGAAACA
oligo 86lbc5.0.10.4TTAATATGGATTCTTTTTTTTTTTTTGGATCGGTACATTGT
oligo 84lac5.0.10.5GCATCGGCCTACATTTTGACGACCGCCA
oligo 164lac5.0.10.6GTTTGAAACATGTATTTTTTTTTTTAAGAGTGATGATAGT
oligo 30lbc5.0.11.1AACCGCCCCCAATAGGAACCCACGTTAG
oligo 86lac5.0.11.2GAGAAAGCCCCAAAAACAGGAGTAAACG
oligo 84lbc5.0.11.3GCCATTGCAACAGG
c5.0.12: barrel latch zippers (latch design 2)
oligo 30lazc5.0.12.1GTATGGTCGCACCGGTGAGTACCGCTA
oligo 179lazc5.0.12.2GTTGGTCTGAGTGCCGCACGGCAATAA
oligo 139lac5.0.12.3TGATCTTCTATCGTCGTTGTGAGCGAT
oligo 86lbzc5.0.12.4GTATTCGACCGATCCGGACTTTCTAGG
oligo 84lazc5.0.12.5CGGGGACGCTAACGTGTTGCAGTTTTA
oligo 164lazc5.0.12.6ATGCTGGCCACTCTTCATGGGTGCTGA
c5.0.13 and 14: top lid latches (13) and "splits" (14)
oligo 64lac5.0.13.1GCCGATTTATAACGTGCTTTCTTTAGGCAACTCGAATAC
oligo 49lac5.0.13.2GTCTATATCACCCATTTTTTTTAAACATCCGTCCCCG
oligo 8lac5.0.13.3CATTTGAGATTCGCCTGATTGTTTTTTTTTTTTTCTCTTGCCAGCAT
oligo 49lbc5.0.14.1AATCAATGGCAAGTGTAGCGCGCCGCG
oligo 8lbc5.0.14.2CTTTGAATACCAAGAAAGAAA
c5.0.15: top lid zippers (latch design 2)
oligo 64lazc5.0.15.1ACAATGTAGTTGCCTGGTTAAGGGTAC
oligo 49lazc5.0.15.2ACCTGATGGATGTTTATCAACGGGTGT
oligo 8lazc5.0.15.3ACTATCATAAGAGAACGCCGTCTCAGC
c5.0.16 and 17: bottom lid latches (16) and "splits" (17)
oligo 80lac5.0.16.1TAATTTCCTGACGAGAAACACTTTTTTTAGAGACGACCATAC
oligo 30lac5.0.16.2GGATTAGCCCTCAGTTTTTTTTTTGTAGTAGAGACCAAC
oligo 52lbc5.0.16.3CCTTCATTATTCATTTTTTTTTTTTTCCTACGAGAAGATCA
oligo 30lbc5.0.17.1AACCGCCCCCAATAGGAACCCACGTTAG
oligo 52lac5.0.17.2CATCGCCTGGCTGA
oligo 52lcc5.0.17.3TACCCAAGGCTCAT
c5.0.18: bottom lid zippers (latch design 2)
oligo 80lazc5.0.18.1AAACTTCTGTCTCTATCTCTTCAGTCG
oligo 30lazc5.0.18.2AATTGTAGCTACTACCGAAGGCTATTC
oligo 52lbzc5.0.18.3TGTTTCCCTCGTAGGTCAGTGCTTGTG
c5.0.19: barrel latch displacers
oligo 30ladc5.0.19.1TAGCGGTACTCACCGGTGCGACCATAC
oligo 179ladc5.0.19.2TTATTGCCGTGCGGCACTCAGACCAAC
oligo 139ladc5.0.19.3ATCGCTCACAACGACGATAGAAGATCA
oligo 86lbdc5.0.19.4CCTAGAAAGTCCGGATCGGTCGAATAC
oligo 84ladc5.0.19.5TAAAACTGCAACACGTTAGCGTCCCCG
oligo 164ladc5.0.19.6TCAGCACCCATGAAGAGTGGCCAGCAT
c5.0.20: top lid displacers
oligo 64ladc5.0.20.1GTACCCTTAACCAGGCAACTACATTGT
oligo 49ladc5.0.20.2ACACCCGTTGATAAACATCCATCAGGT
oligo 8ladc5.0.20.3GCTGAGACGGCGTTCTCTTATGATAGT
c5.0.21: bottom lid displacers
oligo 80ladc5.0.21.1CGACTGAAGAGATAGAGACAGAAGTTT
oligo 30ladc5.0.22.2TTATTGCCGTGCGGCACTCAGACCAAC
oligo 52lbdc5.0.23.3CACAAGCACTGACCTACGAGGGAAACA

Oligo order (7/24)

Just core oligos. No aptamers or latches. Biotinylated oligos were ordered seperately, also 7/24.

c5.0.1: core barrel oligos
oligo 0c5.0.1.1TAAAGTATAGCATT
oligo 1c5.0.1.2AAGTCAGAGGGTAATTGAGCGAAACCGAGGAAACGCTGGCAT
oligo 2c5.0.1.3GATTAAGTCTACTAATAGTAGCGGTGTCTGGAAGTATGCTGT
oligo 3c5.0.1.4AGCTCAAAAAGACTTCAAATAAGCAAAGCGGATTGGTAATAG
oligo 4c5.0.1.5TAAAATGAGGCAAGTCCGCTACGTATAAGGCGCTCACAATTC
oligo 5c5.0.1.6CACACAAGCCAGCTGCATTAAGGTAGAAAGATTCATACCAGT
oligo 6c5.0.1.7CAGGACGTTGGGAAGAAAAATACAAAGCTGCTCATATCCCTT
oligo 8c5.0.1.8ACTAAATGTGGCGAGAAAGGAAGGCCGATTAAAGGGAGGCCA
oligo 9c5.0.1.9CCGAGTATCCAGAACAATATTCTCAATCGTCTGAAACAGACA
oligo 10c5.0.1.10ATATTTTAAAAATACCGAACGAACCACCAGCAGAAAAGCATC
oligo 11c5.0.1.11ACCTTGCCTTGATACCGATAGTTTTTCACGTTGAAAATCTCC
oligo 12c5.0.1.12AAAAAAATCCAGACGTTAGTACCACCAGAAGGAGCCTGATTG
oligo 13c5.0.1.13TTTGGATTATACTTCTGAATACGTCAGATGAATATCCGCCAC
oligo 14c5.0.1.14CCTCAGACCAGGCGGATAAGTTGCCTATTTCGGAATACATGG
oligo 15c5.0.1.15CTTTTGATCAGACGATTGGCCCCCTCAGAACCGCCTCGGTCA
oligo 16c5.0.1.16TAGCCCCGGCTTATCCGGTATCCAGTTACAAAATAAACAGCC
oligo 17c5.0.1.17ATATTATGCAGCCTTTACAGAACCGTCACCGACTTTTTTGTC
oligo 18c5.0.1.18ACAATCAATAGAAAATTCATAAGTATGTTAGCAAACAGATAG
oligo 19c5.0.1.19CCGAACAGCAATAAAGCCTCAGAGCATAAAGCTAATATTTCA
oligo 20c5.0.1.20ACGCAAGTGATATTCAACCGTTAGCATGTCAATCATAAATCA
oligo 21c5.0.1.21GCTCATTCAGCTTTCATCAACTCTGCCAGTTTGAGACCGCTT
oligo 22c5.0.1.22CTGGTGCCAAGGCGATTAAGTTGGGTAACGCCAGGCGACGGC
oligo 23c5.0.1.23CAGTGCCATTCATTGAATCCCATAGTAAGAGCAACACTATCA
oligo 24c5.0.1.24TAACCCTGGAATACCACATTCCCCGCTTTCCAGTCAGCTGAT
oligo 25c5.0.1.25TGCCCTTCACCGCCTGGCCCTCTGGTTTGCCCCAGTAGTAAA
oligo 26c5.0.1.26TTGGGCTCAGATGAACGGTGTCAATCATAAGGGAAAAAAGAA
oligo 27c5.0.1.27TACACTATAATGCCACTACGACTGAGGCTTGCAGGACAACAA
oligo 28c5.0.1.28CCATCGCTGAGAGCCAGCAGCGACAACTCGTATTAAATCCTT
oligo 29c5.0.1.29TACTTTTGCGGGAGAAGCCTTATCGGTTGTACCAATACCGAA
oligo 31c5.0.1.30AATCCAACCCAATAGCAAGCAGCAAGCCGTTTTTACGCCTGT
oligo 32c5.0.1.31TTATCAACAATAGATAAGTCCAGTAATTCTGTCCACCTCAGA
oligo 34c5.0.1.32TTACCGTTACTAGAAAAAGCCATAGGTCTGTCCAATCGCAAG
oligo 35c5.0.1.33ACAAAGAGCGATAGCTTAGATGGTTTTGCTCAGTAACCGCCA
oligo 36c5.0.1.34CCCTCAGAACACTGAGTTTCGATGGGATTTTGCTATTGCGAA
oligo 37c5.0.1.35TAATAATTTGCGCCGACAATGGAGTTAAAGGCCGCTTGGCAG
oligo 38c5.0.1.36ATTCACCACTCAAACTATCGGCCTTGCTGGTAATAAAAGAGT
oligo 39c5.0.1.37CTGTCCAGACCCCCAGCGATTTACTTAGCCGGAACGAGGCGC
oligo 40c5.0.1.38AGACGGTACAGACCAGGCGCAAAGGAGCGGGCGCTAAATCAA
oligo 41c5.0.1.39GTTTTTTGGGGTCGAGGTGCCACTATTAAAGAACGGTTTGAT
oligo 42c5.0.1.40GGTGGTTGTGAGACGGGCAACGGGAAACCTGTCGTCATACGA
oligo 44c5.0.1.41CAGGCAAAGCGCCATTCGCCAGTGTAGATGGGCGCCTATTAT
oligo 45c5.0.1.42AGTCAGATCGCGTTTTAATTCGAGCTTCAAAGCGAATGGCTT
oligo 46c5.0.1.43AGAGCTTCATTAAATTTTTGTTATGTACCCCGGTTGATAATC
oligo 47c5.0.1.44AGAAAAGGCCGGAGACAGTCAAAGGTGGCATCAATACTCCTT
oligo 48c5.0.1.45ATTACGCTGGTTTACCAGCGCGGAAATTATTCATTATCGATA
oligo 49c5.0.1.46GCAGCACTTTCATCGGCATTTACCCTCAGAGCCACGAGAATA
oligo 50c5.0.1.47TAAAGTATTGAGAATCGCCATATTTAACAACGCCAATACCGA
oligo 51c5.0.1.48CCGTGTGACTGGTAATAAGTTAGTGCCCGTATAAACAGTTAA
oligo 52c5.0.1.49TGCCCCCGCCGTCGAGAGGGTATTTTCCCTTAGAAGGAAACA
oligo 53c5.0.1.50GTACATAAATCAATATATGTGTTTGAATACCAAGTTTTTACA
oligo 54c5.0.1.51TCGGGAGTCATCAATATAATCGGAATTATCATCATGTTGAAA
oligo 55c5.0.1.52GGAATAACAAACCCTCAATCAAAAACATCGCCATTTGAATGG
oligo 56c5.0.1.53CTATTAGTCTTTAA
oligo 57c5.0.1.54TATTTTTGATAATCGTAAAACTCTAGCTGATAAATATAACCT
oligo 58c5.0.1.55GTTTAGCACATAAAGGTGGCAACGGAATAAGTTTAGAGCCAT
oligo 59c5.0.1.56TTGGGAAACCATTACCATTAGCCATCTTTTCATAAACCGGAA
oligo 61c5.0.1.57ACGCTCAACCGGAATCATAATTCCAGTAAGCGTCACCTATTA
oligo 62c5.0.1.58TTCTGAAACATGAAAGTATTAATTAGGATTAGCGGTAAGACG
oligo 63c5.0.1.59CTGAGAATTAATTACATTTAACAATTTCATTTGAAATTTCAA
oligo 64c5.0.1.60TTACCTGATTTTCAGGTTTAAATGGAAGGGTTAGAAACATTA
oligo 66c5.0.1.61CAGAGGTCTGACCTGAAAGCGTAAGAATACGTGGCATGGATT
oligo 68c5.0.1.62AAATACGAAACACTCATCTTTTCACGCAAATTAACGTTAGAA
oligo 69c5.0.1.63TCAGAGCGGGAGCTAAACAGGAGGGAAGAAAGCGATAGGCTG
oligo 70c5.0.1.64GCTGACCTTGCCCTGACGAGAGAACTGGCTCATTATCAGTTG
oligo 71c5.0.1.65AGATTTACGTTTACCAGACGACGTCCAATACTGCGGGTCTTT
oligo 72c5.0.1.66ACCCTGAATCGTAACCGTGCAATTAAATGTGAGCGAGTAACA
oligo 73c5.0.1.67ACCCGTCTTTGTTAAAATTCGAATTGCTGAATATATTCATTC
oligo 74c5.0.1.68CATATAACAGTTGATTCCCAAGGGCGCGAGCTGAAAATCACC
oligo 76c5.0.1.69AAATTAAAAGTTACCAGAAGGCTAATATCAGAGAGAACAGGG
oligo 77c5.0.1.70AAGCGCACAGAGCCTAATTTGTCTAAGAACGCGAGAAGAACG
oligo 79c5.0.1.71GTAATAACACCCTCAGAGCCGGCCAGCATTGACAGGAGGTTG
oligo 80c5.0.1.72AGGCAGGTGATACAGGAGTGTATAAATAAGGCGTTTTTCAAA
oligo 81c5.0.1.73TATATTTTAGTTAATTTCATCGTCGCTATTAATTATGATATA
oligo 82c5.0.1.74AGTATAGAGGAGGTTTAGTACCATTCCACAGACAGAGTTTTG
oligo 83c5.0.1.75TCGTCTTAGGCTCCAAAAGGATTGCTTTCGAGGTGAAAGACA
oligo 85c5.0.1.76ATCATACAGGCAAGGCAAAGATTTAAATGCAATGCAAAGGGT
oligo 87c5.0.1.77CCGTGGGGATAGGTCACGTTGTTCAGGCTGCGCAACCTCTTC
oligo 88c5.0.1.78GCTATTACGCCAGCTGGCGAAGACCTTTGATAGCGTTTAGAC
oligo 90c5.0.1.79TATTACATGAATCGGCCAACGGGCGCCAGGGTGGTTTTTCTT
oligo 91c5.0.1.80TTCACCACCGAAATCGGCAAATCAGTGAATAAGGCTTCATCA
oligo 92c5.0.1.81AGAGTAAGACCTGCTCCATGTATACCAAGCGCGAAGACTTTT
oligo 93c5.0.1.82TCATGAGCACCCTCAGCAGCGAATTTCTTAAACAGTGAACCT
oligo 94c5.0.1.82CAAATATTACATTTGAGGATTTAGAAGTATTAGACGCGGAAC
oligo 96c5.0.1.83CCTGTAGCGCCACCCTCAGAAACAGTAACAGTACCTACAAAA
oligo 97c5.0.1.84TCGCGCAGAGGCGAATTATTCTTACCTTTTTTAATTCCTTGA
oligo 98c5.0.1.85AAACATAACGCGAGAAAACTTAAATAAGAATAAACACAGTAG
oligo 99c5.0.1.86GGCTTAACCGACAAAAGGTAATGAACAAGAAAAATAACCAAG
oligo 100c5.0.1.87TACCGCACTCATCGAGAACAAAATCAGATATAGAACTTATTA
oligo 101c5.0.1.88GCGTTTGCAAGGCCGGAAACGTCACCAATGAAACCAAAGGTG
oligo 102c5.0.1.89AATTATCGAGAATAACATAAAATAACCCACAAGAATTGAGTT
oligo 103c5.0.1.90AAGCCCATTAAGAAAAGTAAGCGTAGAAAATACATTATATTT
oligo 105c5.0.1.91CGGAAGCTAAATCAAAAATCAGAATCGTCATAAATAAGCTTG
oligo 106c5.0.1.92CATGCCTGCATAAAGTGTAAAGCCTGGGGTGCCTACGTTGCG
oligo 107c5.0.1.93CTCACTGAACTAATGCAGATACATTGTGAATTACCTTATGCG
oligo 109c5.0.1.94CAACGTCAAAGGGCGAAAAACGTGAACCATCACCCAGGGCGC
oligo 110c5.0.1.95TGGCAAGCCACACCCGCCGTCCGTTGTAGCAATACGCCTGAG
oligo 111c5.0.1.96TAGAAGAAGTCACACGACCAGGAGATAGAACCCTTGAGGCGG
oligo 112c5.0.1.97TCAGTATTAACACC
oligo 113c5.0.1.98ATGGTCATAATGCC
oligo 114c5.0.1.99CGCGTCTGGCCTTCCTGTAGCTTTTAACCAATAGGTCCTTTT
oligo 115c5.0.1.100GATAAGAAGATTTAGTTTGACCATTAGA
oligo 116c5.0.1.101AAGCCCGCATGTTT
oligo 117c5.0.1.102TAATTGCAACGCCA
oligo 118c5.0.1.103CACTCCAGCCAGCTTTCCGGCGGGACGACGACAGTAACGAGA
oligo 119c5.0.1.104ATGACCAAAACTCCAACAGGTCAGGATT
oligo 120c5.0.1.105AGAGGGGCATCAAA
oligo 121c5.0.1.106TTCAGAAATCGGCC
oligo 122c5.0.1.107ACGAGGCCCTCAAA
oligo 123c5.0.1.108TAACGGATTGCAAA
oligo 124c5.0.1.109CTTTAATCATAACG
oligo 125c5.0.1.110CAACGTACTACGTT
oligo 126c5.0.1.111AAGAGGATGAGATG
oligo 127c5.0.1.112TGACGGGGGATATT
oligo 128c5.0.1.113ATAAATTGTGTCGAAATCCGCTCTTGACAAGAACCGAAAGCC
oligo 129c5.0.1.114GGCGAACCGGAACCCTAAAGGGAGCCCC
oligo 130c5.0.1.115AAGAGGCCCGAACT
oligo 131c5.0.1.116AGAAGTGAGATTTG
oligo 132c5.0.1.117ACAGAGGCTTTGAGGACTAAAACAAAGTACAACGGTTTTTAT
oligo 133c5.0.1.118AATCAGTGATTTTAGACAGGAACGGTAC
oligo 134c5.0.1.119TCGGTCGAGGCACC
oligo 135c5.0.1.120GGAAATAAACGAGG
oligo 136c5.0.1.121TATCAGCGCCTTTA
oligo 137c5.0.1.122GCCACGCCCACGCA
oligo 138c5.0.1.123AGAAAGGAACAACTAAAGGAAAACAACTTTCAACATTAAAAG
oligo 140c5.0.1.124GATCTAACCCTCAT
oligo 141c5.0.1.125ATTAATTGTTTCAG
oligo 142c5.0.1.126CAATAGGAACCCATGTACCGTAGCCACCACCCTCAAAGAAAT
oligo 143c5.0.1.127TGCGTAGAGCAAAAGAAGATGATGAAAC
oligo 144c5.0.1.128CGTACTCCCCGGAA
oligo 145c5.0.1.129AGAAATATTTTCAG
oligo 146c5.0.1.130GAGAAGGAGAGGCT
oligo 147c5.0.1.131GAGTAACTTAACGG
oligo 148c5.0.1.132CGCAGTCTTAAAGC
oligo 149c5.0.1.133AGCCGCCCCACCAG
oligo 150c5.0.1.134AGCCACCTCAAAAT
oligo 151c5.0.1.135TAGCGTCCTCCCGA
oligo 152c5.0.1.136GCTGTCTTTCCTTATCATTCCGCGTTTTAGCGAACAGACTGT
oligo 153c5.0.1.137AGCGCGTCGTAATCAGTAGCGACAGAAT
oligo 154c5.0.1.138CAGTAGCTTAGAGC
oligo 155c5.0.1.139GGAGGGATAACTGA
oligo 156c5.0.1.140TTTGAAGCCTTAGCGTCTTTCTTAGACGGGAGAATAGGTAAA
oligo 157c5.0.1.141TATTGACCAAAGACAAAAGGGCGACATT
oligo 158c5.0.1.142AGACACCACATATA
oligo 159c5.0.1.143AAAAGAACAATAAT
oligo 160c5.0.1.144GCTATCTAAACATT
oligo 161c5.0.1.145TTAACGTAAACAAT
oligo 162c5.0.1.146TACCGCGATAAGAA
oligo 163c5.0.1.147CAGAACGTTTTCAT
oligo 164c5.0.1.148GCATTTTAGAAACC
oligo 165c5.0.1.149TATACAAACAACAT
oligo 166c5.0.1.150GTTTGAAACATGTA
oligo 167c5.0.1.151CAAAATCTGTTTAG
oligo 168c5.0.1.152GTAAATCTTCTGAC
oligo 169c5.0.1.153AACAAAAGAGTCAA
oligo 170c5.0.1.154TGATTGCAGTGAAT
oligo 171c5.0.1.155TGGCAATAAACAAT
oligo 172c5.0.1.156ATCAACAATTCCTG
oligo 173c5.0.1.157TAGCCCTATATCTG
oligo 174c5.0.1.158GCCAACATAATAAA
oligo 175c5.0.1.159ATCACTTTTCTTTG
oligo 176c5.0.1.160GTAACCATGTAGCG
oligo 177c5.0.1.161CCACTACCGTCTAT
oligo 178c5.0.1.162GGGTTGAAAAAGAA
oligo 179c5.0.1.163GTCCACGGAGAGAG
oligo 180c5.0.1.164CGTATTGCGCGGGG
oligo 181c5.0.1.165TTAATTGATGAGTG
oligo 182c5.0.1.166TAGTACCGCGACCG
oligo 183c5.0.1.167TGTAAAAGTTTTCC
oligo 184c5.0.1.168GTGCGGGCTGTTGG
oligo 185c5.0.1.169GTAATGGAACAAAC
oligo 186c5.0.1.170TTAAATTAGATTGT
oligo 187c5.0.1.171AGATTCACTGAGTA
c5.0.2: top lid oligos
oligo 0c5.0.2.1CCCTGCCAGGGATC
oligo 1c5.0.2.2GCCGCCACCAGAACCACCACCCGGAAGTTGGAAGCATCTGTA
oligo 2c5.0.2.3AGCAACTCCCTGGAGTGACTCCAGTGCCAAGCTTTCGCCAGG
oligo 3c5.0.2.4GTTTTCCTTCCGGCACCGCTTCGACAGTATCGGCCCTGTAGC
oligo 4c5.0.2.5CAGCTTTCAATAGGAACGCCAGTAAAACTAGCATGGAGAGTC
oligo 5c5.0.2.6TGGAGCAAGTAATGTGTAGGTAAATTTTTAGAACCCATTAAC
oligo 6c5.0.2.7ATCCAATCGAGCTGAAAAGGTGTTTTAAATATGCATTAGAGC
oligo 7c5.0.2.8TTAATTGCAAAAAGATTAAGAGGAAGCCCGAAAGACAAAAAT
oligo 8c5.0.2.9CAGGTCTCCAGAGGGGGTAATAGTAAAATGTTTAGAAGAGCA
oligo 9c5.0.2.10ACACTATTCTGGAAGTTTCATCTGTTTAGCTATATTTTCATT
oligo 10c5.0.2.11TGGGGCGAAATCATACAGGCACGATTTTAAGAACTATCAACG
oligo 11c5.0.2.12TAACAAAGCTGCTCATTCAGTGAACGGTGTACAGAGTGAGAA
oligo 12c5.0.2.13AGGCCGGATCTACAAAGGCTATCAGGTCATTGCCTTCAATCA
oligo 13c5.0.2.14TATGTACCTCATCTTTGACCCCTACAGAGGCTTTGAGGACTA
oligo 14c5.0.2.15AAGACTTGCTTGCAGGGAGTTGTGAGCGAGTAACACCGTGCA
oligo 15c5.0.2.16TCTGCCAGTTTGAGGGGACGACTGGTGCCGGAAACAATAATA
oligo 16c5.0.2.17ATTTTTTACGATCTAAAGTTTTGTCGTCTTTCCAGATGTACC
oligo 17c5.0.2.18GTAACACGGGTGGATGTTCTTAACCCCGCTTCTAATCTATTT
oligo 18c5.0.2.19ACGCTCGCGTCGGTGGGCACGTGCTCAGTACCAGGTTGAGTA
oligo 19c5.0.2.20ACAGTGCCCGTATAAACAGTTATTTACCGTTCCAGCATTGAC
oligo 20c5.0.2.21AGGAGGTTGAGGCAGGTCAGAAACAGGGCTTAAGCGAATCGG
oligo 21c5.0.2.22CTGACGCTGTCCCGCCAAAATCTAAGTGGTTGTGATGGCGAA
oligo 22c5.0.2.23AGGGGGATTCGCCATTCAGGCTGGGCGCATCGTAAACCCGTC
oligo 23c5.0.2.24GGATTCTAAATTCGCATTAAAAGAAAAGCCCCAAAGCTATTT
oligo 24c5.0.2.25TTGAGAGAGACAGTCAAATCAAATACTTTTGCGGGCAAAATT
oligo 25c5.0.2.26AAGCAATAAATGGTCAATAACTCCATATAACAGTTTTTAATT
oligo 26c5.0.2.27GCTCCTTTTTTAATTCGAGCTTCAAAGCGAACCAGCAAATGC
oligo 27c5.0.2.28TTTAAACAATACTGCGGAATCGTCATAA
oligo 28c5.0.2.29TCCTGGTTGGTGTAATGAGTACGATTGGCCTTGATAAGCCAG
oligo 29c5.0.2.30AATGGAAAGCGCAGTCTCTGAAATGCCCCCTGCCTAAGAGAA
oligo 30c5.0.2.31GGATTAGCCCTCAGAACCGCCCCCAATAGGAACCCACGTTAG
oligo 31c5.0.2.32TAAATGAATAGAAAGGAACAACTTAAACAGCTTGAATTCGGT
oligo 32c5.0.2.33CGCTGAGTTTCATGAGGAAGTGAAAGAGGCAAAAGGCTCCAT
oligo 33c5.0.2.34GTTACTTGAAAGAGGACAGATGAATAAGGCTTGCCAACTTTA
oligo 34c5.0.2.35ATCATTGAAAGATTCATCAGTTTACGAGGCATAGTACTGGAT
oligo 35c5.0.2.36AGCGTCCAGTTCAGAAAACGAGAATGACCATAAATCTTCAAA
oligo 36c5.0.2.37TATCGCGTTGATAAGAGGTCATTTTTGCGGATGGCACTAAAG
oligo 37c5.0.2.38TACGGTGCATAACCCTCGTTTACTAACGGAACAACATTATTA
oligo 38c5.0.2.39CAGGTAGTGAATTACCTTATGAGGCAAAGAATTAGAGAAGCC
oligo 39c5.0.2.40TTTATTTCAACGCAAGGATAAAAAGATTCAAAAGGCCAGGCG
oligo 40c5.0.2.41CATAGGCTGATAAATTGTGTCGAAATCCGCGACCTAATACAC
oligo 41c5.0.2.42TAAAACACCCGGTTGATAATCTTTTTGTTAAATCAGCTCATT
oligo 42c5.0.2.43TTTTAACCATCAACATTAAATAAAGGCCGCTTTTGTTTATCA
oligo 43c5.0.2.44GCTTGCTTTCGAGGTGAATTTCTAAAGGAATTGCGCAGGCAA
oligo 44c5.0.2.45AGCGCCATGTGCTGCAAGGCGATTAAGTTGGGTAACTCAGGA
oligo 45c5.0.2.46GAAGCCATGAGTTTCGTCACCACCGTACTCAGGAGGTTTAGT
oligo 46c5.0.2.47ACCGCCAGATTAGCGGGGTTTAATATAGGGGCCTTTACGTGG
oligo 47c5.0.2.48TGCTTGTTACCTCGATAAAGAAGAGCCGCCGCCAGTAAGCGT
oligo 48c5.0.2.49CATACATGGCTTTTGATGATAACGGGGTCAGTGCCCGGATAA
oligo 49c5.0.2.50GTGCCGTGGAATAGGTGTATCAGTACAAACTACAATCATAGT
oligo 50c5.0.2.51TAGCGTACACGTTGAAAATCTTTTAATTGTATCGGCGGGATC
oligo 51c5.0.2.52GTCACCCGAGGGTAGCAACGGCCAGCGATTATACCTTTGTAT
oligo 52c5.0.2.53CATCGCCTGGCTGACCTTCATTATTCATTACCCAAGGCTCAT
oligo 53c5.0.2.54TATACCACGTTAATAAAACGAACCAGACGACGATACAAAAGA
oligo 54c5.0.2.55AGTTTTGTTACCCTGACTATTATAGTCA
oligo 55c5.0.2.56GAATTGTCAACCTTATGACAAATTTCACATAAATCGGCTGAG
oligo 56c5.0.2.57ACTCCTCATTTCGGAACCTATTATTCTG
oligo 57c5.0.2.58ATTAAGAATTTCTC
oligo 58c5.0.2.59CGACGGCTATGATA
oligo 59c5.0.2.60CCTCTTCGCTATTACGCCAGCATTCATGCGCACGATCAGGGA
oligo 60c5.0.2.61TAGCAAGACCCTCAGAACCGCCACCCTC
oligo 61c5.0.2.62CTCATTTCTTAAGT
oligo 62c5.0.2.63GCCAGCTCAGTCAC
oligo 63c5.0.2.64GATAGGTCACGTTGGTGTAGATGCGCAACTGTTGGTCAGCGG
oligo 64c5.0.2.65AGTGAGAATTTTCTGTATGGGATTTTGC
oligo 65c5.0.2.66AACAGTTGAAGGGC
oligo 66c5.0.2.67GGCCTTCTCAGGAA
oligo 67c5.0.2.68GTAAACGTTAATATTTTGTTACCGTGGGAACAAACCGCATAA
oligo 68c5.0.2.69CCGATATTACCGATAGTTGCGCCGACAA
oligo 69c5.0.2.70TCGCCCAGGCGGAT
oligo 70c5.0.2.71GGTAATCTCAAAAA
oligo 71c5.0.2.72AAATTAATGCCGGAGAGGGTAAACAGGAAGATTGTCACCAAC
oligo 72c5.0.2.73CTAAAACTTCCATTAAACGGGTAAAATA
oligo 73c5.0.2.74ACGAAGGATAAGCA
oligo 74c5.0.2.75ATGCCTGAACAAGA
oligo 75c5.0.2.76CCAAAAACATTATGACCCTGTCCATCAATATGATAAACTGAC
oligo 76c5.0.2.77CAACTTTAGCCGGAACGAGGCGCAGACG
oligo 77c5.0.2.78GGAACCGTTCAACC
oligo 78c5.0.2.79GTAGTAGCTCATAT
oligo 79c5.0.2.80TGACCATTAGATACATTTCGCAAAGCCTCAGAGCAGATGGTT
oligo 80c5.0.2.81TAATTTCCTGACGAGAAACACCAGAACG
oligo 81c5.0.2.82GGCTTGATAAAGCT
oligo 82c5.0.2.83TCAACATGGCATCA
oligo 83c5.0.2.84AGGTCAGGATTAGAGAGTACCGATTCCCAATTCTGAACGCCA
oligo 84c5.0.2.85AAAGGAATGAGATTTAGGAATACCACAT
oligo 85c5.0.2.86GATACATCGAACGA
oligo 86c5.0.2.87ATTGCATCTGAATA
oligo 87c5.0.2.88TCCCCCTACCGGAA
oligo 88c5.0.2.89GCTTTTGAAAACCA
oligo 89c5.0.2.90AAATCTAGTCAGGA
oligo 90c5.0.2.91AACCGGACAAGAGT
oligo 91c5.0.2.92ACGGAGAAAGCGCG
oligo 92c5.0.2.93TCGGAACTCAGCAG
oligo 93c5.0.2.94AGGAGCCCCAAAAA
oligo 94c5.0.2.95ACAGCCCCGCCTGT
oligo 95c5.0.2.96ATAGCCCCGAGAGG
oligo 96c5.0.2.97AGTTTTACAGGAGT
oligo 97c5.0.2.98CTCATTAATTCACA
c5.0.3: bottom lid oligos
oligo 0c5.0.3.1CATTAAAGTAGCGC
oligo 1c5.0.3.2CGTTGCGCTCACTGCCCGCTTTTTAGCGTCAGACTGGTGAAT
oligo 2c5.0.3.3TATCACCAGGGAGGGAAGGTAATGTTAGCAAACGTCCAAAAG
oligo 3c5.0.3.4AACTGGCACCCACAAGAATTGCAAAGTCAGAGGGTGTTACAA
oligo 4c5.0.3.5AATAAACACCAACGCTAACGACCAATAGCAAGCAACAAGCCG
oligo 5c5.0.3.6TTTTTATGCCTGTTTATCAACACGACGACAATAAATTCTTAC
oligo 6c5.0.3.7CAGTATAACTAGAAAAAGCCTGATGCAAATCCAATCTCCGGC
oligo 7c5.0.3.8TTAGGTTGTGAGTGAATAACCTTGCTTCTGTAAATACAATTT
oligo 8c5.0.3.9CATTTGAGATTCGCCTGATTGCTTTGAATACCAAGAAAGAAA
oligo 9c5.0.3.10TTGCGTACGCGAGAAAACTTTAATAAGAATAAACACCGGAAT
oligo 10c5.0.3.11CATAATTAAGCCAACGCTCAATAACATTATCATTTACTAATA
oligo 11c5.0.3.12GATTAGAGCCGTCAATAGATAAATCAATATCTGGTGAACAAG
oligo 12c5.0.3.13AAAAATAACCAAGTACCGCACTCATCGAGAACAAGATCAGAT
oligo 13c5.0.3.14ATAGAAGCGCGAACTGATAGCTCACCAGTCACACGACCAGTA
oligo 14c5.0.3.15ATAAAAGCATTGCAACAGGAATCCCAATCCAAATAGACGGGA
oligo 15c5.0.3.16GAATTAACTGAACACCCTGAAAGTTAAGCCCAATACAGAATC
oligo 16c5.0.3.17CTGAGAACGCCGCTACAGGGCGCGTACTATGGTTGAAAGCGA
oligo 17c5.0.3.18AAGGAGCTAAAGGTGGCAACAAGACAAAAGGGCGACATTCAA
oligo 18c5.0.3.19CCGATTGGTCACCGACTTGAGCAACGTCAAAGGGCAAATCCT
oligo 19c5.0.3.20GTTTGATGGTGGTTCCGAAATGGGCAACAGCTGATCTGTCGT
oligo 20c5.0.3.21GCCAGCTGCATTAATGAATCGGATAGCAGCACCGTGAGCCAG
oligo 21c5.0.3.22CAAAATCTTTACCAGCGCCAATATAAAAGAAACGCTTACCAG
oligo 22c5.0.3.23AAGGAAACAATGAAATAGCAAAGGGAAGCGCATTAAGAAACG
oligo 23c5.0.3.24ATTTTTTAGTTGCTATTTTGCCTAAGAACGCGAGGAGAACGG
oligo 24c5.0.3.25GTATTAAATATCCCATCCTAAAGAATATAAAGTACTGAGAAT
oligo 25c5.0.3.26CGCCATATAAATAAGGCGTTATTCAAATATATTTTGAATTTA
oligo 26c5.0.3.27TCAAAATAATTTTCCCTTAGAATCCTTGAAAACATATGATGA
oligo 27c5.0.3.28AACAAACAGAGGCGAATTATTCATTTCA
oligo 28c5.0.3.29AACGTCACCAATGAAACCATCGCCAACGCGCGGGGGGGTGGT
oligo 29c5.0.3.30TTTTCTTTTCACCAGTGAGACCGGCAAAATCCCTTAGAGTCC
oligo 30c5.0.3.31ACTATTAACTAAATCGGAACCGAAAGGAAGGGAAGCTTTGAC
oligo 31c5.0.3.32GAGCACGAAAGGGATTTTAGATAGTAATAACATCAATATTAC
oligo 32c5.0.3.33CGCCAGCGGACATTCTGGCCAATTTTTGAATGGCTCTGCAAC
oligo 33c5.0.3.34AGTGCCAAATATCAAACCCTCATACATTTGAGGATCGAACGT
oligo 34c5.0.3.35TATTAATCCTGATTGTTTGGACGTAAAACAGAAATTTACAAA
oligo 35c5.0.3.36ATCGCGCATCAAGAAAACAAAATTAATTACATTTACGTCGCT
oligo 36c5.0.3.37ATTAATTCATAGGTCTGAGAGACTACCTTTTTAACCGCAAGA
oligo 37c5.0.3.38CAAAGAAGATTTTCAGGTTTATCAGATGATGGCAATTCATCA
oligo 38c5.0.3.39ATATAATTTTAAAAGTTTGAGCAGTAGGGCTTAATCGACAAA
oligo 39c5.0.3.40AGGTAAAGTAATTCTGTCCAGAATAGATAAGTCCTCAGTTGG
oligo 40c5.0.3.41CAAATCAGAGGTGAGGCGGTCAGTATTAACACCGCATTAGTC
oligo 41c5.0.3.42TTTAATGGCTTATCCGGTATTACCCAGCTACAATTTTATCCT
oligo 42c5.0.3.43GAATCTTAGCCATATTATTTAAAACGCTCATGGAATTAACCG
oligo 43c5.0.3.44TTGTAGCAATACTTCTTTGATCAGGAACGGTACGCATAAGAG
oligo 44c5.0.3.45CAAGAAACCGAGGAAACGCAATAATAACGGAATACAGAAAAT
oligo 45c5.0.3.46ACATACAGGGCGCTAGGGCGCGTTTTTTGGGGTCGAGGTGCC
oligo 46c5.0.3.47GTAAAGCAAGAACGTGGACTCCCATTTGGGAATTAAATCAGT
oligo 47c5.0.3.48AGCGACAGAATCAAGTTTGCCTCCAGTCGGGAAACTGCCCTT
oligo 48c5.0.3.49CACCGCCTGGCCCTGAGAGAGGCCCCAGCAGGCGAGAAAAAC
oligo 49c5.0.3.50CGTCTATATCACCCAAATCAATGGCAAGTGTAGCGCGCCGCG
oligo 50c5.0.3.51CTTAATGGTGTTTTTATAATCGTCCATCACGCAAAATACCTA
oligo 51c5.0.3.52CATTTTGTTACATTGGCAGATCCTAAAACATCGCCCAGAAGA
oligo 52c5.0.3.53TAAAACAACAGTTGAAAGGAATAGGAGCACTAACATGCGGAA
oligo 53c5.0.3.54CAAAGAACATATTCCTGATTAACGTCAGATGAATAGAGAAAC
oligo 54c5.0.3.55AATAACGATTACCTTTTTTAATGGAAAC
oligo 55c5.0.3.56ATCAATAGAAAATTCATATGGACCAGTAGCACCATTCCAGTT
oligo 56c5.0.3.57TGGAACAATAAATCAAAAGAATAGCCCG
oligo 57c5.0.3.58GTGTTGTTACCATT
oligo 58c5.0.3.59ACGCAGTAATATTG
oligo 59c5.0.3.60TAAGCAGATAGCCGAACAAAGAAAGACACCACGGAGGCGAAC
oligo 60c5.0.3.61GTGGCGACTAAAGGGAGCCCCCGATTTA
oligo 61c5.0.3.62GAAAGCCATAAGTT
oligo 62c5.0.3.63AGAGATAATGATTA
oligo 63c5.0.3.64CAGAGAGAATAACATAAAAACTAGCTATCTTACCGACAGGAG
oligo 64c5.0.3.65GCCGATTTATAACGTGCTTTCCTCGTTA
oligo 65c5.0.3.66GAGCTAAAAGCCCT
oligo 66c5.0.3.67TTTGCCAAATTGAG
oligo 67c5.0.3.68TTGAAGCCTTAAATCAAGATTGTTTAACGTCAAAATAATATC
oligo 68c5.0.3.69CAGAACACTTGCCTGAGTAGAAGAACTC
oligo 69c5.0.3.70TTGCTGGATGAAAA
oligo 70c5.0.3.71ACCGCGCGCGTCTT
oligo 71c5.0.3.72CTGTCTTTCCTTATCATTCCACGTTTTAGCGAACCGTGGCAC
oligo 72c5.0.3.73AGACAATACAGAGATAGAACCCTTCTGA
oligo 73c5.0.3.74AGAATACTCCCGAC
oligo 74c5.0.3.75AGAACGCTTTCATC
oligo 75c5.0.3.76CATTTTCGAGCCAGTAATAAGTTTACGAGCATGTACTTGCTG
oligo 76c5.0.3.77AACCTCACGCTGAGAGCCAGCAGCAAAT
oligo 77c5.0.3.78GCATCACGAAACCA
oligo 78c5.0.3.79ATACAAACAACATG
oligo 79c5.0.3.80TTTGAAATACCGACCGTGTGATTTAACAACGCCAATTAAATC
oligo 80c5.0.3.81CTTTGCCTTAGAAGTATTAGACTTTACA
oligo 81c5.0.3.82ACTCGTACATGTAA
oligo 82c5.0.3.83AAATGCTGTTTAGT
oligo 83c5.0.3.84ACGCTGAGAAGAGTCAATAGTAGTTAATTTCATCTCAAAATT
oligo 84c5.0.3.85ATTTGCATTATACTTCTGAATAATGGAA
oligo 85c5.0.3.86ACCATATTCTGACC
oligo 86c5.0.3.87AATATATGGGTTAT
oligo 87c5.0.3.88AAAGAAGAGCGATA
oligo 88c5.0.3.89ACATCGGTACAGTA
oligo 89c5.0.3.90TTATCATACCACCA
oligo 90c5.0.3.91ATATCTTTTGAGGA
oligo 91c5.0.3.92CCACCAGATTAAAA
oligo 92c5.0.3.93GGATTATACGCTCA
oligo 93c5.0.3.94AGAGTCTAGTGAGG
oligo 94c5.0.3.95CCACACCGTCACGC
oligo 95c5.0.3.96GTGAACCCAGGGCG
oligo 96c5.0.3.97CTGGTTTTTGCAGC
oligo 97c5.0.3.98GGCGCCAAGAGGCG
c5.0.4: barrel oligos @ outside aptamers -aptamers
oligo 7c5.0.4.1ATAAATCGTGTTGTTCCAGTTTGGAACAAGAGTCCGTAAAGC
oligo 43c5.0.4.2GCCGGAAGCAGGTCGACTCTAAGGGGGATGTGCTGCGGAAAC
oligo 65c5.0.4.3TCATTTTTTTACAAACAATTCAAATGAAAAATCTAGATAAAA
oligo 75c5.0.4.4ATCAATAGATAAAAATTTTTAGAACCCTCATATATATTAGCA
oligo 78c5.0.4.5GGTATTAAATATCCCATCCTAATTTACGAGCATGTCGAGCCA
c5.0.5: barrel oligos @ inside aptamers -aptamers
oligo 33c5.0.5.1GCCGCCATTGATATTCACAAACAAATAAATCCTCATCTGAAT
oligo 67c5.0.5.2ATTTACATTTTGCGGGATCGTGAAGTTTCCATTAAACGGGTA
oligo 89c5.0.5.3TGGATAGCGATAAAAACCAAAATAGCGAGAGGCTTACAACAT
oligo 95c5.0.5.4AAAGAAAAATGAATTTTCTGTTCACCAGTACAAACTACAACG
oligo 104c5.0.5.5TCATTTGTTCTGCGAACGAGTGGTCATTTTTGCGGACCAGAC
c5.0.6: barrel oligos @ top latches -latches
oligo 60c5.0.6.1CCGCCTCGACGACGACAATAAATTCTTACCAGTATAAAGCCA
oligo 84c5.0.6.2GCATCGGCCTACATTTTGACGACCGCCAGCCATTGCAACAGG
oligo 86c5.0.6.3GAGAAAGCCCCAAAAACAGGAGTAAACGTTAATATGGATTCT
c5.0.7: barrel oligos @ bottom latches -latches
oligo 30c5.0.7.1GCCCTTTATAATAAGAGCAAGCAAAAATGAAAATATTATCCC
oligo 108c5.0.7.2ATTTTAAAACACCAGAACGAGCAGGCGAAAATCCTTGGACTC
oligo 139c5.0.7.3TTTGAGTACCTACCATATCAAAATTATT
c5.0.8: barrel outward biotinylated oligos
oligo 7c5.0.8.1ATAAATCGTGTTGTTCCAGTTTGGAACAAGAGTCCGTAAAGCTTT-biotin
oligo 43c5.0.8.2GCCGGAAGCAGGTCGACTCTAAGGGGGATGTGCTGCGGAAACTTT-biotin
oligo 65c5.0.8.3TCATTTTTTTACAAACAATTCAAATGAAAAATCTAGATAAAATTT-biotin
oligo 75c5.0.8.4ATCAATAGATAAAAATTTTTAGAACCCTCATATATATTAGCATTT-biotin
oligo 78c5.0.8.5GGTATTAAATATCCCATCCTAATTTACGAGCATGTCGAGCCATTT-biotin
c5.0.9: barrel inward biotinylated oligos
oligo 33c5.0.9.1GCCGCCATTGATATTCACAAACAAATAAATCCTCATCTGAATTTT-biotin
oligo 67c5.0.9.2ATTTACATTTTGCGGGATCGTGAAGTTTCCATTAAACGGGTATTT-biotin
oligo 89c5.0.9.3TGGATAGCGATAAAAACCAAAATAGCGAGAGGCTTACAACATTTT-biotin
oligo 95c5.0.9.4AAAGAAAAATGAATTTTCTGTTCACCAGTACAAACTACAACGTTT-biotin
oligo 104c5.0.9.5TCATTTGTTCTGCGAACGAGTGGTCATTTTTGCGGACCAGACTTT-biotin


Program Output

oligo path
oligo token list

Sorted Oligos

lid1 oligo sequence list
lid2 oligo sequence list
barrel oligo sequence list

Personal tools