IGEM:Harvard/2006/Cyanobacteria/Notebook/2006-7-28

From OpenWetWare

Jump to: navigation, search



Contents

Results from yesterday's site specific mutagenesis

Overall fail; though only one positive control came across (one wasn't ran on the gel) out of 3. Could our template not exist? More analysis needed.

Click for legend
Click for legend
Click for legend
Click for legend
Click for legend
Click for legend


Verification of sequencing

Peng verified the M13R primers with the biobricks site and searched for overall homology with the other constructs; could not find anything substantial, will work with Perry later to see if I'm missing something. HH6 though looks like it isn't what we're looking for... but why would it be missing biobricks sites?

Ideas for future

Trying kit; looking at colony; primer analysis.

Sequencing results from GeneWiz

>>M13R GCTTTTAGGTGNCTATAGAAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCCTTATCCTGTTTTTTTGGGTGGAGTAATAATTTCTGCACATCTAACCATTATTAAATTTAATAATAAGTATCGGGTTTGTTACGATAGAATATTTCTATATCCTCAAGAATATGCTTTGCCTTATTGCCTGTGACTTTCTGAGATTCAATTATAGTATCGTTAAATTCTAATGTTAAAGAGAACTCTTTTTTCCGCTTTGTGTAAGTTTAACCTTATATTGATTACCAATATCAAATAAAAAGGTCCTGTAATGAGAATAATCACCTTTAACCTCCTCGGCAAAACAGCAAAGCGTGCAAATATACATAAAGTCTTTCTTACCCCTGATTTTGTTAACTAAATCAATAAATGCGTGAAAAACTTTACTTGCAATAGAACTTGATACTTCTTCTCCAGGTCTAAAAAATCTTTTGCAATTTTTAACTGTGTTTCTATGTATAAAAAGAAATCTTTGGCATAAGAGATATCTTTATTATTTAGTGCATCTAGCTCAACAGGTAAAGATGTCGTTTTGTTGCTATTCACATATGATATATTCATATCATCATCTCCATCGCGAGTAATAAAATTAATCACCATTGTAGGGTAGGGGGCTGGTCAATCAGAAATCATCTTTATAAACTTCGATTGTTTTTGTAATGCTGTATCATTAAGTTCATTAAATCGTACAGCAGATAAATGTTCTATCAAATTTCGCTCATTTGCCGAGGATTCATCATAATAAACGTAAATTANTG

>>M13F

CTCTATAGGGCGAATTGGGCCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCATCCCAGCCATTGTTCATTTTTTCCCAGAACACAGGATTTTTCAGATAATCTTCGCTTTCTGGCGAGAAGGTTTTTTTGCCGCGCCAGAAGCCCGGACTGGAAAAAAGTACCGTGTCATCGATATCAAACCCCACCGCCATTGGCGGACGCCCTGCGAGGCTATTTTCAATTTGTGCGACCGAAACCCAATGAATGGGTGCCTGTTCAGCAAGCCTGGCAACGTTAGTCCCAGGGTTAAGCGGTGAAGGAGATGAGGCCAGGGCAACAGCGGAACTGTTTAGAGCGAACAATAAGCAAACGGCACTGATTGCCTGTGTGATCTTGCGCATATTTTTCCCTAAATAGTCAGTATGTTGAAACTTTTTATTGTGAGATTTGTTGCAAAAACCATCTGACCATAACGCCAGCTGCCGGGGAAAGGAAGGATTATCTGCGGTTTTTGTGATGAAAAGCAGGATGATTATATTTAACCCAGTAAATACGTTCCTGTCTTTTTTTGTATAAAAAATGTTTATTACTCGATGTAAGGATACATTAATTTTACGTTTATTATGATGAATCCTCGGCAAATGAGCGAAATTTGATAGAACATTTATCTGCTGTACGATTTAATGAACTTAATGATACAGCATTACAAAAACAATCGAAGTTTATAAAGATGATTTCTGATTGACCAGCCCCCTACCCTACAATGGTGATTAATTTTATTACTCGCGATGGAGATGATGATATGAATATATCATATGTG
Personal tools