IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/06/15

From OpenWetWare

Jump to: navigation, search
iGEM Project name 1 Main project page
Previous entry      Next entry

Team Flavour

Primer Designs for Agrobacterium Vector

  • Primers were designed to amplify from the Expression Series pORE Agrobacterium plasmid (e3) 1)the pENTcup2 promoter, 2) the tNOS stop sequence, 3) the tNOS stop sequence + additional stop codon and 4) the pHLP promoter.

Note: the NOSterm_BB_R primer works for both tNOS and tNOS+STOP codon sequences.

   pENTcup2_BB_F
   CCTTTCTAGAGGGATCTTCTGCAAGCATCT
   pENTcup2_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTTCCGGTGGGTTTTGAGGT
   STOP_NOSterm_BB_F
   CCTTTCTAGATGAGATCGTTCAAACATTTGG
   NOSterm_BB_F
   CCTTTCTAGAGATCGTTCAAACATTTGGCA
   NOSterm_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTGATCTAGTAACATAGATGACA
   pHPL_BB_F
   CCTTTCTAGAAACGTGGATACTTGGCAGTG
   pHPL_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTCTTTTGAGCTTAGAGGTTTTT

BioBrick Transformation

  • Colonies were observed after overnight culture growth, but in low quantities.
    • J45700 and J45004 (both Wintergreen Pathway) showed minimal number of colonies on both 10μL and 100μL cultures.
    • J45250 and J45014 (both Banana Pathway) showed no colonies on either the 10μL or 100μL cultures.

Codon Usage in Arabidopsis

Using http://gcua.schoedl.de/

Wintergreen Pathway:
BioBrick Part #: BBa_J45700
Original Organism: Pseudomonas aeruginosa

BBa_J45700 BBa_J45700 BBa_J45700 BBa_J45700

Banana Pathway:
BioBrick Part #: BBa_J45014
Original Organism: Saccharomyces cerevisiae
BBa_J45014 BBa_J45014 BBa_J45014

BioBrick Part #: BBa_J45250
BBa_J45250 BBa_J45250 BBa_J45250 BBa_J45250

Valencene Pathway:

Valencene Valencene Valencene

Valencene Extraction

Used RNeasy Plant Mini Kit to extract RNA from the flavedo of an Organic Valencia Orange.

Flavedo


Team Genetic Fence

Oligonucleotides for LacI

the following sequences for LacI and a Nuclear Localization Signal (NLS) were ordered for PCR:

LacIn.BB.Rev

   5'-AAG GCT GCA GCG GCC GCT ACT AGT TCA AAC CTT TCT CTT CTT CTT AGG ATG AAC AAC AGA AGA CTG CCC GCT TTC CAG TCG GGA AA - 3'

LacIn.BB.Fwd

   5'- CCT TGA ATT CGC GGC CGC ATC TAG AAT GAA ACC AGT ACC GTT ATA CGA TGT C -3'

NLS.BB.Rev

   5'-GCG GCC GCT ACT AGT TCA AAC CTT TCT CTT CTTCTT AGG ATG AAC AAC AGA AGA -3'

NLS.BB.Fwd

   5'-CTA GAT CTT CTG TTG TTC ATC CTA AGA AGA AGA GAA AGG TTT GAA CTA GTA GCG GCC GCT GCA -3'

VP16 transcription activating domain bacterial transformation

Performed bacterial transformation according to Silver:_Bacterial_Transformation, however we used 1μL in step 3, and used entire tube of TOP10 competent cells instead of only 10-15μL.

Transformed the following into its own tube of TOP10 E.Coli:

VP16 Eukaryotic Activating Domain, biobrick BBa_K105001, located on plate 3, well 13C, plasmid pSB1A2.

In the course of reconsitituting the the biobrick plasmid from its well, too little DH2O was added (1μL), so an additional 10μL were added to the well.

The first tube of TOP10+biobrick plasmid was erroneously heatshocked before being chilled for 30 mins on ice, so a second tube of TOP10 cells was introduced, and the correct proceedure followed for the second tube. Additionally, the first tube was then allowed to chill and heat shock again, ultimately producing two tubes of transformed TOP10 cells.

100μL of both tubes were streaked onto an LB + Amp dish, and incubated at 37°C on the plates overnight. Colonies the following morning, colonies were observed on both plates, although fewer on the plate containing the E.Coli which were erroneously heat-shocked too soon.


LacI Miniprep Preparations

Prepared 6 overnight cell cultures, consisting of three colonies each from the LacI wt and LacI+rapid degradation tail E.Coli cells transformed previously.

Each culture consisted of 5mL of LB+Amp, and a scraping of 1 E.Coli colony, in a 100cc tube.

These overnight cell cultures were set to shake at 37°C overnight.




Personal tools