IGEM:IMPERIAL/2006/project/primers/Cre Lox
From OpenWetWare
< IGEM:IMPERIAL | 2006 | project | primers
Primer 1
- Primer 1 is the same as the sense streand and consists of
- Restriction Sites – Lox Site – Stop Codon – First 20 bases of part B0021
GAATTCGCGGCCGCTTCTAGAGCGATAACTTGGTATAGCATACATTATACGAACGGTATGAAAATAATAAAAAAGCGG
Primer 2
- We need both the sense strand and the anti-sense strand for this primer
- 31bp into part B0021 (long due to a run of T and A)
- 22bp into part I13521
Sense Strand :
CGGATTAATAATCTGGCTTTTTATATTCTCTTATAAACGCAGAAAGGCCCACC
Antisense Strand:
GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG
Primer 3
- Primer 3 contans a section complementary to the sense strand of the construct and a Lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it.
CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC
For further information on incorporation [here]


