
From OpenWetWare

Jump to: navigation, search

The melting temperatures were calculated mostly by the following site: Oligonucleotide Primer Check

  • scFv (pCT-4-4-20, pCT302 S101A, pCT-4M5.3 anti-fluorescein plasmids)
         rand   EcoRI   NotI      XbaI       Primer
         rand    SpeI   Stop          FLAG Tag                 Primer
  • FecA
             rand    EcoRI    NotI    XbaI     primer
             rand    SpeI     stop    primer
                     rand    EcoRI    NotI      XbaI     primer
                     rand    PstI     NotI      SpeI     primer
  • FecR
fecR-Fwd 5' CATCAT  GAATTC  GCGGCCGC TCTAGA tgaatcctttgttaaccgattccc 3'T_m 66 
             rand   EcoRI     NotI     XbaI   primer
fecR-Rev 5' GCCATA  ACTAGT  TTATTA ttacagtggtgaaatgtttatccag 3' T_m 68
             rand   SpeI     stop   primer

Middle Fwd 5'gtgaaagcctacagttcagcgcctcag3'  T_m 84
Middle Rev 5'ctgaggcgctgaactgtaggctttcac3'  T_m 84
  • FecI
fecI-Fwd 5'CATCAT GAATTC GCGGCCGC T TCTAGA tgtctgaccgcgccactacc3' T_m 68
           rand   EcoRI    NotI     XbaI  primer
fecI-Rev 5'GCCATA CTGCAG CGGCCGC T ACTAGT A TTATTA tcataacccatactccagacggaa3' T_m 70
            rand  PstI    NotI      SpeI     stop  primer
  • MalE (updated/fixed)
fwd: 5' CCGTTA  GAATTC GCGGCCGC T TCTAGA atgaaaataaaaacaggtgcacgc3' T_m,i=68.8 T_m,f=85.5
         junk    EcoRI    NotI     XbaI       Primer
         junk    PstI    NotI      SpeI   Stop        Primer
  • PhoA
             junk    EcoRI    NotI     XbaI       Primer
             junk    PstI    NotI      SpeI   Stop        Primer
 fwd: 5' caccgcggaactgcaagatgcgaccccggcg 3' T_m=88.8
 fwd: 5' aggcttttttctgcaagtggaaggcgcgagc 3' T_m=82.2
Personal tools