IGEM:MIT/2005/Sequences of primers specified

From OpenWetWare

Jump to: navigation, search

The melting temperatures were calculated mostly by the following site:Oligonucleotide Primer Check
Reverse Complement
Codon Table
Translation Tools

Contents

Check KO

  • FecA/TetR

gacgttcccgctgaaaaata, FecAKO check left1

gcgactcctgcattaggaag, FecAKO check right1

gcttgcggtattcggaatcttg, FecAKO check left2

TGCGGGACTTAAGCAGCAGTAC, FecAKO check right2

Primers for Sequencing

  • FecR'
VR1 5' attaccgcctttgagtgagc 3' T_m=68.2
VF2 5' tgccacctgacgtctaagaa 3' T_m=68.2
FecR'seq.fwd: 5' ctcactgctttagggacag 3' goes w/ VR1 T_m=67.6
FecR'seq.rev: 5' CTGGCCCTGACGGGTCAGG 3' goes w/ VF2 T_m=70.3
  • FecA'
VR1
VF2
FecA'seq.fwd1: 5' cttacggtcagccgcagc 3' goes w/ FecA'seq.rev2 T_m=71.3
FecA'seq.rev1: 5' ACGGGGATGCCGTCCATC 3' goes w/ VF2 T_m=71.3
FecA'seq.fwd2: 5' cgagcctgggctaccag 3' goes w/ FecA'seq.rev3 T_m=70.7
FecA'seq.rev2: 5' CATACGGGCGGGTGGATTG 3' goes w/ FecA'seq.fwd1 T_m=71.9
FecA'seq.fwd3: 5' gtacagtacagccagattggc 3' goes w/ VR1 T_m=70.8
FecA'seq.rev3: 5' GAACGAGCCTTCAGTGTTTGC 3' goes w/ FecA'seq.fwd2 T_m=70.8
  • PhoA
VR1
VF2
PhoAseq.fwd: 5' ggcaaccgctggtgaatggcag 3' goes w/ PhoAseq.rev2 T_m=76.9
PhoAseq.rev: 5' CAGCAAAGGTTTTTGCGCCGCCG 3' goes w/ VF2 T_m=77.1
  • scFv-linker
scFv-L fwd: 5' gacgtcgttatgactcaaacaccac 3' T_m=74.2
scFv-L rev: 5' GCTGCCCGGCGCGCTGCT 3' T_m=78.2

Fur knockout with Chloramphenicol resistance marker

  • NEW: 41bp homologus with Fur gene + 20-25bp primer to PCR Chloramphenicol gene
Cm fwd: 5' atgactgataacaataccgccctaaagaaagctggcctgaa ctggatctatcaacaggagtcc 3'T_m,i=71.3 T_m,f=89.7 
Cm rev: 5' ttatttgccttcgtgcgcatgttcatcttcgcggcaatcgc GTTGATCGGGCACGTAAGAGGTT 3'T_m,i=73.6 T_m,f=92.1
  • OLD:
Fwd: 5' atgactgataacaataccgccctaaagaaagctggcctgaa gctcgaggcttggattctcac 3' T_m,i=72.8 T_m,f= 90.5
Rev: 5' ttatttgccttcgtgcgcatgttcatcttcgcggcaatcgc ctcgagttgatcgggcacgta 3' t_m,i=72.8 T_m,f=92.4

FecA KO with Chloramphenicol resistance marker

  • homologous to FecA gene + 20-25bp primer designed by Primer3

gtctctcgttttccgcttttgctgcacaggttaatatcgc ctggatctatcaacaggagtcc, FecA-Cm fwd

aggcatctatgcaggccagccgcgcacgctgtatatgcag GTTGATCGGGCACGTAAGAGGTT, FecA-Cm rev

ctggatctatcaacaggagtcc, Cm-left

GTTGATCGGGCACGTAAGAGGTT, Cm-right

FecA knockout with Tetracycline resistance marker

  • homologous to FecA gene + 20-25bp primer designed by Primer3

gtctctcgttttccgcttttgctgcacaggttaatatcgc tgagtaaacttggtctgacagctc, TetR_fwd1

aggcatctatgcaggccagccgcgcacgctgtatatgcag cgctgagataggtgcctcac, TetR_rev1

gtctctcgttttccgcttttgctgcacaggttaatatcgc tgagtaaacttggtctgacagc , TetR_fwd2

aggcatctatgcaggccagccgcgcacgctgtatatgcag cgctgagataggtgcctcac , TetR_rev2

gtctctcgttttccgcttttgctgcacaggttaatatcgc tgagtaaacttggtctgacagc , TetR_fwd3

aggcatctatgcaggccagccgcgcacgctgtatatgcag gctgagataggtgcctcactg , TetR_rev3

gtctctcgttttccgcttttgctgcacaggttaatatcgc atgagtaaacttggtctgacagctc , TetR_fwd4

aggcatctatgcaggccagccgcgcacgctgtatatgcag cgctgagataggtgcctcac , TetR_rev4


  • TetR primers designed by Primer3 (NO FecA homology)

left1 tgagtaaacttggtctgacagctc

right1 cgctgagataggtgcctcac

left2 tgagtaaacttggtctgacagc

right2 cgctgagataggtgcctcac

left3 tgagtaaacttggtctgacagc

right3 gctgagataggtgcctcactg

left4 atgagtaaacttggtctgacagctc

right4 cgctgagataggtgcctcac

  • NEW 41bp homologous w/ FecA gene + 20-25bp primer to PCR Tetracycline resistance
Tet fwd: 5' gtctctcgttttccgcttttgctgcacaggttaatatcgc gagattctcatgtttgacagc 3' T_m,i=66.9 T_m,f=89.9
Tet rev: 5' aggcatctatgcaggccagccgcgcacgctgtatatgcag gcattggtaactcgagttagg 3' T_m,i=68.9 T_m,f=93.3
  • OLD
Fwd: 5' atgacgccgttacgcgtttttcgtaaaacaacacctttggt gagattctcatgtttgacagc 3' T_m,i=66.9 T_m,f=88.5
Rev: 5' tcagaacttcaacgacccctgcatatacagcgtgcgcggct gcattggtaactcgagttagg 3' T_m,i=68.9 T_m,f=92.4

ToxR (ATCC)

Fwd: tctagatgttcggattaggacacaa
Rev: ctgcaggcggccgctactagtcgttaggggtttaaagctgga

scFv

(pCT-4-4-20, pCT302 S101A, pCT-4M5.3 anti-fluorescein plasmids)
FWD: 5' CATCAT GAATTC GCGGCCGC T TCTAGA GACGTCGTTATGACTCAAACACC 3' T_m,i=71.8 T_m,f=88.5
         rand   EcoRI   NotI      XbaI       Primer
REV: 5' GCTCAT  ACTAGT TTATTA CTTATCATCATCATCCTTATAATC GGAGACGGTGACTGAGGTTCC 3' T_m,i=74.7 T_m,f=87.1
         rand    SpeI   Stop          FLAG Tag                 Primer
FWD-flag-test: CATCAT GAATTC GCGGCCGC T TCTAGA TG GACGTCGTTATGACTCAAACACC
                -rand- -EcoRI --NotI--   -XbaI[---]      Primer
                                              start

FecA

fecA-Fwd  5’ CATCAT  GAATTC  GCGGCCGC  TCTAGA TGACGCCGTTACGCGTTTTTCG 3’ T_m,i=73.2 T_m,f=89.6
             rand    EcoRI    NotI    XbaI     primer
fecA-Rev  5’ GCCATA  ACTAGT  TTATTA  TCAGAACTTCAACGACCCCT 3’ T_m,i=68.2 T_m,f=79.9
             rand    SpeI     stop    primer

FecA'

Middle Fwd- 5'GGACGGCAGCGGACTGCAAGTAAAACCGCTGGGAAATAAC 3' T_m=84.7
Middle Rev- 5’GTTATTTCCCAGCGGTTTTACTTGCAGTCCGCTGCCGTCC 3' T_m=84.7

FecA Promoter

  • registry specified 5'-3'
fecA Promoter Fwd- 5’CATCAT  GAATTC  GCGGCCGC T TCTAGA  TGGATAAACATTTCACCACTG 3' T_m,i=65.0 T_m,f=86.2
                      rand    EcoRI    NotI      XbaI     primer
fecA Promoter Rev- 5'GCCATA  CTGCAG  CGGCCGC  T ACTAGT  GTGTTCAGCTATGAGTCGAAC 3' T_m,i= 68.9 T_m,f=89.8
                     rand    PstI     NotI      SpeI     primer
  • registry specified 3'-5'
fecA Promoter Fwd- 5’CATCAT  GAATTC  GCGGCCGC T TCTAGA CACAAGTCGATACTCAGCTTGCTC 3' T_m,i=73.9 T_m,f=87.9
                      rand    EcoRI    NotI      XbaI     primer
fecA Promoter Rev- 5'GCCATA  CTGCAG  CGGCCGC  T ACTAGT ACCTATTTGTAAAGTGGTGACATTCC 3' T_m,i=71.3 T_m,f=89
                      rand    PstI     NotI      SpeI     primer

FecR

fecR-Fwd 5' CATCAT  GAATTC  GCGGCCGC TCTAGA tgaatcctttgttaaccgattccc 3'T_m 66 
             rand   EcoRI     NotI     XbaI   primer
fecR-Rev 5' GCCATA  ACTAGT  TTATTA ttacagtggtgaaatgtttatccag 3' T_m 68
             rand   SpeI     stop   primer

FecR'

Middle Fwd 5'gtgaaagcctacagttcagcgcctcag3'  T_m 84
Middle Rev 5'ctgaggcgctgaactgtaggctttcac3'  T_m 84

FecI

fecI-Fwd 5'CATCAT GAATTC GCGGCCGC T TCTAGA tgtctgaccgcgccactacc3' T_m 68
           rand   EcoRI    NotI     XbaI  primer
fecI-Rev 5'GCCATA CTGCAG CGGCCGC T ACTAGT A TTATTA tcataacccatactccagacggaa3' T_m 70
            rand  PstI    NotI      SpeI     stop  primer

==MalE== (updated/fixed)

fwd: 5' CCGTTA  GAATTC GCGGCCGC T TCTAGA atgaaaataaaaacaggtgcacgc3' T_m,i=68.8 T_m,f=85.5
         junk    EcoRI    NotI     XbaI       Primer

rev: 5' ACTGAG  CTGCAG GCGGCCGC T ACTAGT TTATTA  TTACTTGGTGATACGAGTCTGC 3' T_m,i=69.5 T_m,f=89.4
         junk    PstI    NotI      SpeI   Stop        Primer

PhoA

  • NEW:
fwd2: 5' CATGAG  GAATTC GCGGCCGC T TCTAGA gtgaaacaaagcactattgcactggc 3' T_m,i=74.5 T_m,f=89.7
rev2: 5' AAGCTA  CTGCAG GCGGCCGC T ACTAGT TTATTA TTATTTCAGCCCCAGAGCGGCTTTC 3' T_m,i=75.8 T_m,f=90.4
E1fwd: 5' cgatgctgcctcactgaactcggtgacggaagcgaatcag 3' T_m=88.2
E1rev: 5' CTGATTCGCTTCCGTCACCGAGTTCAGTGAGGCAGCATCG 3' T_m=88.2
E2fwd: 5' cgtacaacgggcgctggagttcgctaaaaaggagggtaac 3' T_m=87.2
E2rev: 5' GTTACCCTCCTTTTTAGCGAACTCCAGCGCCCGTTGTACG 3' T_m=87.2
  • OLD:
fwd: 5'     CATGAG  GAATTC GCGGCCGC T TCTAGA ATGAAACAGAGCACCATTGCG 3' T_m,i=68.9 T_m,f=88.8
             junk    EcoRI    NotI     XbaI       Primer
rev: 5'     AAGCTA  CTGCAG GCGGCCGC T ACTAGT TTATTA TTATTTCAGGCCCAGCGCC 3' T_m,i=69.7 T_m,f=89.8
             junk    PstI    NotI      SpeI   Stop        Primer
Middle(1)
 fwd: 5' caccgcggaactgcaagatgcgaccccggcg 3' T_m=88.8
                        *
 rev: 5' CGCCGGGGTCGCATCTTGCAGTTCCGCGGTG 3' T_m=88.8
                        * 
Middle(2)
 fwd: 5' aggcttttttctgcaagtggaaggcgcgagc 3' T_m=82.2
                        *
 rev: 5' GCTCGCGCCTTCCACTTGCAGAAAAAAGCCT 3' T_m=82.2
                        *

Adding Terminal Linker in scFv

 linker fwd1: 5'GACGTCGTTATGACTCAAACACC 3' T_m,i= 71.8
                    primer
 linker rev1': 5' CGCGCTGCCGCTATGGCTCGCGCTGTTCGGGGAGACGGTGACTGAGGTTC 3' T_m,i=74.7 T_m,f=95.9 
                                                     primer
 linker fwd2: 5' CATCAT GAATTC GCGGCCGC T TCTAGA GACGTCGTTATGACTCAAACACC 3' T_m,i=71.8 T_m,f=88.5
                 rand   EcoRI   NotI      XbaI       primer
 linker rev2': 5' GCTGCCCGGCGCGCTGCTGGTGTTCGGCGCGCTGCCGCTATGGCTCG 3' T_m,i=74.7 T_m,f=98.5
                                                     primer
 linker rev3: 5' GCTCAT  ACTAGT CTTATCATCATCATCCTTATAATC TCCGGACCGTCGTCTAGTTCT 3' T_m,i=72.8 T_m,f=86.9
                  rand    SpeI       FLAG Tag                 Primer
  • Verifying addition:
scFv-L fwd: 5' gacgtcgttatgactcaaacaccac 3' T_m=74.2
scFv-L rev1: 5' GCTGCCCGGCGCGCTGCT 3' T_m=78.2
scFv-L rev2: 5' CTATGGCTCGCGCTGTTCGG 3' T_m=74.7

FecA-scFv fusion

Note: scFv_rev_Tm=76.6 (44.8%); scFv_fwd_Tm=82.5 (81.0%)

Rev_primer=first_29_bp_of_scFv(reversecomplemented) + 21_bp_of_FecA(reversecomplemented)

Fwd_primer=last_21_bp_of_scFv + 21_bp_of_FecA

more documentation in http://web.mit.edu/ymk/Public/igem/feca_scfv_fusions2.txt

  • Final: Type1s
Rev138: gatAGTGGTGTTTGAGTCATAACGACGTC GTCACGCGCGCCAGCATGTTC T_m=76.7
Fwd138: accagcagcgcgccgggcagc gtgatccgccgtgaggatttc T_m=72.8
Rev155: gatAGTGGTGTTTGAGTCATAACGACGTC ctcacgcatggtggttgcgcc T_m=76.7
Fwd155: accagcagcgcgccgggcagc gtacttaaccgcatccctggc T_m=72.8
Rev176: gatAGTGGTGTTTGAGTCATAACGACGTC caggtcgtggctgccggtgcc T_m,fec=80.6
Fwd176: accagcagcgcgccgggcagc gcgatgaactttggcatccggggc T_m,fec=79
Rev178: gatAGTGGTGTTTGAGTCATAACGACGTC catcgccaggtcgtggctgcc T_m=78.6
Fwd178: accagcagcgcgccgggcagc aactttggcatccggggcctg T_m=74.7
Rev180: gatAGTGGTGTTTGAGTCATAACGACGTC aaagttcatcgccaggtcgtggctg T_m,fec=77.5
Fwd180: accagcagcgcgccgggcagc ggcatccggggcctgaacccg T_m,fec=80.6
Rev527: gatAGTGGTGTTTGAGTCATAACGACGTC cgccggaagcggtgcgttata T_m=74.7
Fwd527: accagcagcgcgccgggcagc ttgaacgtgctctatcacctg T_m=68.9
Rev571: gatAGTGGTGTTTGAGTCATAACGACGTC tcgcgctttttccggttcaac T_m=70.8
Fwd571: accagcagcgcgccgggcagc acctgggaactcggtacccgc T_m=76.7
  • Final: Type2s
Rev138-141: gatAGTGGTGTTTGAGTCATAACGACGTC acgcgcgccagcatgttcaaa T_m=72.8
Fwd138-141: accagcagcgcgccgggcagc cgtgaggatttcgccaaaacc T_m=70.8
Rev155-158: gatAGTGGTGTTTGAGTCATAACGACGTC acgcatggtggttgcgccggt T_m=76.7
Fwd155-158: accagcagcgcgccgggcagc cgcatccctggcgtcagcgcg T_m=80.6
Rev176-180: gatAGTGGTGTTTGAGTCATAACGACGTC gtcgtggctgccggtgccgtt T_m=78.6
Fwd176-180: accagcagcgcgccgggcagc ggcatccggggcctgaacccg T_m=80.6
Rev178-182: gatAGTGGTGTTTGAGTCATAACGACGTC cgccaggtcgtggctgccggt T_m=80.6
Fwd178-182: accagcagcgcgccgggcagc cggggcctgaacccgcgcctc T_m=82.5
Rev180-184: gatAGTGGTGTTTGAGTCATAACGACGTC gttcatcgccaggtcgtggct T_m=74.7
Fwd180-184: accagcagcgcgccgggcagc ctgaacccgcgcctcgccagc T_m=80.6
Rev521-529: gatAGTGGTGTTTGAGTCATAACGACGTC gctcacttcttcgtgcgtgcc T_m=74.7
Fwd521-529: accagcagcgcgccgggcagc gtgctctatcacctgactgac T_m=70.8
Rev523-531: gatAGTGGTGTTTGAGTCATAACGACGTC gttatagctcacttcttcgtg T_m=66.9
Fwd523-531: accagcagcgcgccgggcagc tatcacctgactgacagctgg T_m=70.8
Rev527-531: gatAGTGGTGTTTGAGTCATAACGACGTC cggaagcggtgcgttatagct T_m=72.8
Fwd527-531: accagcagcgcgccgggcagc tatcacctgactgacagctgg T_m=70.8
Rev567-576: gatAGTGGTGTTTGAGTCATAACGACGTC ttcaacattgccgctttgcacagc T_m,fec=73.9
Fwd567-576: accagcagcgcgccgggcagc acccgctacgacgacggcgcg T_m,fec=80.6
Rev571-574: gatAGTGGTGTTTGAGTCATAACGACGTC cgctttttccggttcaacattgccgc T_m,fec=77.6
Fwd571-574: accagcagcgcgccgggcagc ctcggtacccgctacgacgac T_m,fec=76.7
Personal tools