IGEM:MIT/2008/Notebook/Yogurt/2008/06/16

From OpenWetWare

Jump to: navigation, search
iGEM Project name 1 Main project page
Next entry

Entry title

  • sequence of prtB signal in L. Bulgaricus

3' TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA 5' amino acid sequence M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T

  • amino acid sequence of p1025

Q L K T A D L P A G R D E T T S F V L V



Personal tools