IGEM:MIT/2009/DNA/MTS

From OpenWetWare

Jump to: navigation, search

ATGCAACGCTCCATTTTTGCGAGGTTC


Met-Gln-Arg-Ser-Ile-Phe-Ala-Arg-Phe

Personal tools