IGEM:MIT/2009/DNA/PCBsynthesis

From OpenWetWare

Jump to: navigation, search

pcyA - I15009 in the registry (750bp)

ATGGCCGTCACTGATTTAAGTTTGACCAATTCTTCCCTGATGCCTACGTTGAACCCGATGATTCAACAGT TGGCCCTGGCGATCGCCGCTAGTTGGCAAAGTTTACCCCTCAAGCCCTATCAATTGCCGGAGGATTTGGG CTACGTAGAAGGCCGCCTGGAAGGGGAAAAGTTAGTGATTGAAAATCGGTGCTACCAAACGCCCCAGTTT CGCAAAATGCATTTGGAGTTGGCCAAGGTGGGCAAAGGGTTGGATATTCTCCACTGTGTAATGTTTCCTG AGCCTTTATACGGTCTACCTTTGTTTGGCTGTGACATTGTGGCCGGCCCCGGTGGAGTAAGTGCGGCTAT TGCGGATCTATCCCCCACCCAAAGCGATCGCCAATTGCCCGCAGCGTACCAAAAATCATTGGCAGAGCTA GGCCAGCCAGAATTTGAGCAACAACGGGAATTGCCCCCCTGGGGAGAAATATTTTCTGAATATTGTTTAT TCATCCGTCCCAGCAATGTCACTGAAGAAGAAAGATTTGTACAAAGGGTAGTGGACTTTTTGCAAATTCA TTGTCACCAATCCATCGTTGCCGAACCCTTGTCTGAAGCTCAAACTTTGGAGCACCGTCAGGGGCAAATT CATTACTGCCAACAACAACAGAAAAATGATAAAACCCGTCGGGTACTGGAAAAAGCTTTTGGGGAAGCTT GGGCGGAACGGTATATGAGCCAAGTCTTATTTGATGTTATCCAATAATAA

HY2 Sequence AT3G09150.2

ATGGCTTTATCAATGGAGTTTGGGTTTTCAATTGGGTCATGCTTCAAGGCACCAAACCCACCTGTTCTAA TCTCTGCAAGCCCTAATAAGATCAATTTCACGTTGAGAAGGAGAAAGAAAAGATTCTTACTTAGAGTCTC TGCTGTGTCGTATAAGGAATTCGCAGAGTCTGCTTTAGAAGAAACCAGGAAAAGGATCGTTCTTGAACCT TCACATCTCCAGGAAAAGTATAGTAGCATGACAGGACTAGATGGTAAGACCGAACTTCAAATGCTTGCTT TTAAATCTTCAAAGATTAGACTCTTGAGGAGTATGGCAATAGAGAATGAGACAATGCAGGTCTTTGACTT TGCGGGTTTCATGGAGCCTGAGTATGATACTCCCATATTCTGTGCTAACTTTTTCACATCTACCAACGTT AACATAGTTGTATTGGACCTTAATCCTTTGCATCAGTTGACTGACCAGACGGATTACCAAGACAAGTATT ATAACAAGATAATGTCCATATATCACAAATATGCTGAGACTTTCCCATGGGGAGGGAAATTGACTGGTGA ATCCATAAAGTTTTTCTCGCCTTTGGTGATGTGGACTAGGTTTTCGTCTAGCAAAGAAAAACATAAGGCT TTGTTCTCTGCGTTTCTAGAGTACTATCAGGCATGGCTTGAGATGACAATCCAAGTGAGGGAGGAGATGG AACCATCTCATGTGAGAGCCAATTGTGAAGCACAACACAAGTACCTGACATGGCGAGCACAAAAGGATCC TGGACATGGTCTTCTTAAAAGATTAGTAGGTGAAGCAAAGGCAAAGGAGCTGCTAAGGGATTTCCTGTTC AATGGGGTGGATGAGTTAGGCACAAAAACATTCATTGATTACTTTCCAGAGTACCAAACAGAAGATGGAA CTGTAAGCGATAAACGAAGTATCATTGGGAAGTCATATGAAACTCGTCCATGGGATTTAACAGGACAATT TATCGGCTAA

=======================

Oligos for XmaI-Kozak-ATG-MTS-SpeI

=======================

C CCGGG AACAAA ATG CAA CGC TCC ATT TTT GCG AGG TTC A CTAGT GGGCC C TTGTTT TAC GTT GCG AGG TAA AAA CGC TCC AAG TGATC A


XmaI_mts1(+), CCGGG AACAAA ATG CAA CGC TCC ATT TTT GCG AGG TTC A


SpeI_mts1(-), CTAGT GAA CCT CGC AAA AAT GGA GCG TTG CAT TTTGTT C

Personal tools