IGEM:Peking University/2008/Experiment/PKU 0517 G2 1

From OpenWetWare

Jump to: navigation, search

Primer design

Primer 1
  • Primer name: F-Gal4-HindIII-Apal
  • Sequence(5'to3'):AAAAAGCTTGGGCCCTTTTAAGAGAGGACAGAGAAGCAAGCCTC
  • Tm:64.1°C
Primer 2
  • Primer name: R-Gal4-EcoRI-Xhol
  • Sequence(5'to3'):GGGGAATTCCTCGAGTGCGGGGTTTTTCAGTATCTACGATTCATT
  • Tm:64.0°C


PCR

TITLE: PCR-Budding Yeast Genome-Gal4-K.O.D 50ul
Volume (μL)
Template (Budding Yeast Genome)1
dNTP5
Enzyme1
Buffer5
MgSO4(For KOD)2
F-Gal4-HindIII-ApaI 1
R-Gal4-EcoRI-Xhol1
ddH2O34
conditions
Temperature(&&&)Time Length(0:00:00)
94°C07:00
94°C00:3030 cycles
59°C00:3030 cycles
55°C00:3030 cycles
72°C03:0030 cycles
72°C07:00
4°CHold


back to Main Page
Personal tools