IGEM:Peking University/2008/Experiment/PKU 0620 G2 1

From OpenWetWare

Jump to: navigation, search

Primer design

Primer 1
  • Primer name: F-HindIII-Apal-Gal4
  • Sequence(5'to3'):CCCAAGCTTGGGCCCAAGATGAAGCTACTGTCTTCTATCGAACAA
  • Tm:64.9°C
Primer 2
  • Primer name: R-EcoRI-Spel-Gal4
  • Sequence(5'to3'):GGGGAATTCACTAGTATTTTACTCTTTTTTTGGGTTTGGTGGGGT
  • Tm:61.3°C


PCR

TITLE: PCR-Budding Yeast Genome-Gal4-phusion polymerase 50*6ul
Volume (μL)
Template (pPT1)0.5
dNTP1
Enzyme0.5
Buffer10
F-HindIII-Apal-Gal40.5
R-EcoRI-Spel-Gal40.5
ddH2O37
conditions
TemperatureTime Length(0:00:00)
98°C00:30
98°C00:1030 cycles
57.1,60.4,62.5,64.7,66.9,68.9°C00:3030 cycles
72°C01:3030 cycles
72°C07:00
4°CHold


Enzyme cutting-pPT1-XbaI-20 μL
Volumn(μL)
plasmid5
XbaI0.2
BSA 2
M Buffer2
ddH2O10.8
back to Previous Page
Personal tools