IGEM:PennState/Labbook/NoahJohnson/2007-6-11

From OpenWetWare

Jump to: navigation, search

June 11, 2007


XylA and XylB Primer (Temporarily Suspended)

3725940-3728788 Found on Ecocyc

TTACGCCATT AATGGCAGAA GTTGCTGATA GAGGCGACGG AACGTTTCTC GTCGTGGCTG
ATAAGCGGCA TAACGCTGCG CATCTGGTAG ATGCGACTGT TCTAACGGTA GTTGCGGCAA
CAATTCAATG AGCGATTTCT CTGGATTCGC CGCGATCTGC GCCAGCCTTG CTGCGCCCAG
TGCTGGCCCC ACATCCCCCC CCGTACGGTA ATCGAGCTGC TGACCGCTGA TATCCGCCAG
CATCTGACGC CAGTACTCAC TACGCGCCCC GCCCCCAATC AACGTAACAC TTTGCGGTTT
AATACCGCAG GCATGCACGA CATCCATGCC ATCTGCCAGC GCATAACCCA CGCCTTCCAG
CACTGCTCGC GCCAGTTCAT TGGGGCCATG TTGATGAGTC AAACCAAAGA AAACCCCCTT
CGCCTGGGGA TTATTGTGTG GCGTACGCTC GCCGGAAAGA TAAGGCAGAA ACCAAACTGG
CTCGGCACTT TCATCAGCCT GTTGAGCTGC AGCGATTAAA GCTGGGACAT TGCTCAGGCC
GGTTAATTTC GCGGCCCAAT CCAGACACGA CGCTGCACTC AGCATCACAG ACATTAAATG
CCAACGTTGC GGTAGCGCAT GGCAAAAGCT ATGTACGGCG CTTTCTGGCT TGCTTAAGAA
CCCTTCGCTG ACAGCAAAAT AGACCCCCGA CGTCCCCAGC GATAACATTG CCTGATTAGC
ATCAACCATT CCCACACCAA CTGCACCAGC TGCATTGTCG CCACCGCCTG CGACAACTGG
CACCGTCGCC ATACCCCACG CTTTCGCAAC TTCAGGTAAC AAAGCACCAG TAATTTCGCT
GCCTTCGTAT AATGCGGGCA TCTGGTCACG AGATAAGTCG CAAGCCTGCA GCATGACGTC
ACTCCAGTCA CGCTTTGCGA CATCCAGCCA CATGGTGCCA GCTGCGTCAG ACATATCGCT
GGCAAACTCC CCCGTCATAC GCAGACGCAA GTAATCTTTC GGTAATAATA CTTTGTCGAT
TTGACGGAAT ATCTCCGGCT CATGCCGCTG AACCCATAGC AATTTAGGCG CAGTAAATCC
GGGCATCATC AGGTTGCCGG TAATCACCCG CGATTGCGGA ACTCGCGCTT CCAGCAAAGT
GCACTCTTGC GCACAGCGCC CGTCGTTCCA CAAAATGGCA GGGCGTAACA CCCGTTGCTG
AGCATCCAGC AAGGTTGCTC CGTGCATCTG GCCGGCAATA CCCAATGCTT TAACGTCCTG
CAGAGAATGC TGATCGCCCA GAGCTTTCAT TGCGCGATCA GTTGCCTGCC ACCACTGTTC
CGGGTCTTGT TCCGACCAGA GTGGATGCGG GCGCGAAACG GTCAGCTTTT CCGTTTGCGC
AGCAACCACC TCACCCTGCT CGTTGAGCAA AATAACTTTT ACGCCCGAGG TGCCAAGATC
TATCCCGATA TACATATCGA TCGTTCCTTA AAAAAATGCC CGGTATCGCT ACCGATAACC
GGGCCAACGG ACTGCACAGT TAGCCGTTAT TTGTCGAACA GATAATGGTT TACCAGATTT
TCCAGTTGTT CCTGGCGACC ACTCTGATGC ACCGGAGACA AATGATGTTC CTGAGCATAT
TTGGCTAAAT CTGCCAGTGA CATTTGGCCT TTCAGGATTT GCTGGCCCAA TTCGCTATTC
CAGCCGGAAT AACGCTGCGC GATGCGTTTA TCCAGCTCGC CATCTTCAAT CATGCGCGCT
GCAATTTTCA GCGCCAGTGC CATCGTATCC ATCGCGCCGA TATGACCGTA AAACAGATCA
TATTTATCAG TACTTTGACG ACGTACTTTG GCATCGAAGT TCAGACCACC GGTGGTGAAA
CCGCCTGCTT TGAGAATTTC ATACATCACC AGCGCATTCT CTTCCACACT GTTCGGGAAC
TGGTCGGTGT CCCAGCCCAG TTGCGCATCG CCACGGTTGG CGTCGACAGA ACCGAACAGG
CCAAGCGCAA TGGCGGTGGC TATTTCATGA TGGAAAGAGT GACCTGCCAG CGTCGCGTGG
TTAGCTTCAA TGTTCAGTTT AATCTCTTTT TCCAGACCAA ACTGTTTCAG GAAGCCATAG
ACCGTCGCGG CATCGTAATC ATATTGATGT TTGGTCGGTT CTTGCGGTTT CGGTTCGATA
AGCAACGTGC CCTGGAAACC GATTTTATGT TTATGCTCAA CCACCATCTG CATAAAGCGG
CCCAGTTGTT CACGCTCCTG ACGCAAGTCG GTATTTAACA GCGTTTCGTA ACCTTCACGA
CCGCCCCACA GGACATAGTT TTCACCGCCC AATTTATGGG TTGCTTCCAT CGCTGTAACA
ACTTGCGTTG CCGCCCAGCT GAAGACTTCA GGATCTGGGT TCGTCGCCGC ACCCGCGCCG
TAGCGAGGGT TTGTAAAGCA GTTGGCCGTT CCCCACAGCA GCTTCACGCC GCTCTCTTCT
TGCTTGCCTG CCAGGACATC AACCATTTGC GCAAAATTAT TGATGTACTC TTTTAACGAC
GCGCCCTCAG GGGAAACATC CACATCGTGG AAGCAATAAA ATGGCACATG TAACTTGTGG
AAAAACTCAA ATGCGACATC TGCTTTACGC TTCGCCAACG CCAGTGCCTC ACCAGGCTGC
TGCCACGGAC GATTAAACGC CCCCACACCA AACATATCCG CCCCGTTCCA GCAGAAGGTG
TGCCAGTAGC AGGCGGCAAA ACGCAAGTGC TCTTCCATAC GCTTACCCAA CACCAGTTCG
TCGGGATTGT AGTGACGGAA TGCTAACGGG TTTGAGGATT TTGAGCCTTC ATAACGAACG
CGATCGAGCT GGTCAAAATA GGCTTGCAT

Left side primer: gaattcgcggccgcttctagag TTACGCCATT AATGGCAGAA

Right side primer: ctgcagcggccgctactagta ATGCAAGCCT ATTTTGACCA


XylR Promoter Region Primer (Temporarily Suspended)

3732905-3733001 Found on Ecocyc

CAACCAAACG CCGTTCTTGA TTTTGATAAA AATTTTCTCA AAGCCGGTTA CGTATTACCG
GTTTTGAGTT TTTGCATGAT TCAGCAGGAA AAGAACC

Left side primer: gaattcgcggccgcttctagag CAACCAAACG CCGTTCTTGA

Right side primer: ctgcagcggccgctactagta GGTTCTTTTC CTGCTGAATC

9:30-4 Group meeting 4-5:30

Personal tools