IGEM:Stanford/2009/Project Homeostasis/Primer

From OpenWetWare

Jump to: navigation, search

 

Home Team Project Parts Notebook Archives


Project
Research Proposal
Systems Overview
Cloning Plan
Sequences & Primers
Anti-Inflammation
Device Overview
Parts Design
Challenges
Results
Anti-Immunosuppression
Device Overview
Parts Design
Challenges
Results
Protocols
Modeling
Overview
Notebook
Results
Future Work
Archived Work


Anti-Immunosuppression Device

Primers


[OPTIONAL]: Primers to use GTT TCT TC instead of TATA in front? I.e.

GTTTCTTCgaattcgcggccgcttctagATGGTTTGCTTTTTTTTACCTGCCA

Instead of:

TATA gaattcgcggccgcttctagATGGTTTGCTTTTTTTTACCTGCCA



  • HlyC (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagTTGGTTTGCTTTTTTTTACCTGCC

Reverse: TATA tactagtagcggccgctgcagTTAACCTGTTAATGAAAAATTGAAATC

untire sequence: http://www.ncbi.nlm.nih.gov/nuccore/NC_004431.1/?from=3418210&to=3418884&report=fasta



Added 7/1/09 - Mark


  • HlyC (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagTTGGTTTGCTTTTTTTTACCTGCCACC

Reverse: TATAtactagtagcggccgctgcagCTCTTAACCTGTTAATG





  • HlyB (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagGGAGTCATAATGGATTCTTGTC

Reverse: TATAtactagtagcggccgctgcagGTTAGTCTGACTGTAACTG


  • HlyD (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagATGAAAACATGGTTAATGGGGTTCAGCG

Reverse: TATAtactagtagcggccgctgcagCTCTGAGACTTAACGCTCATG


  • TolC (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagGCAAATGAAGAAATTGCTCC

Reverse: TATAtactagtagcggccgctgcagCGTCATCAGTTACGGAAAGGG


Added 7/1/09 - Ming

  • HlyB (from CFT073)

"Forward": TATAgaattcgcggccgcttctag ATGGATTCTTGTCATAAAATTG

"Reverse": TATAtactagtagcggccgctgcag TTAGTCTGACTGTAACTG


  • HlyD (from CFT073)

"Forward":TATA gaattcgcggccgcttctag ATGAAAACATGGTTAATG

"Reverse": TATAtactagtagcggccgctgcag TTAACGCTCATGTAAACTTTC


  • TolC

"Forward": TATAgaattcgcggccgcttctagATGAAGAAATTGCTCCCCATTC

"Reverse": TATAtactagtagcggccgctgcagTCAGTTACGGAAAGGGTTATG'

  • HlyA

complete genome: [1]


Added 6/28/09 - Robert, Ariana

  • IL-6 fusion gene

"Forward": TATAGAATTCGCGGCCGCTTCTAGAGGGATGCATCACCGGTTCCGC

"Reverse": ATATTACTAGTAGCGGCCGCTGCAGGGATGCATTCATTTGACGAAGAG

  • New IL-6 fusion gene (Joe 7-5)

"Forward: TATAgaattcgcggccgcttctagATGCCAACAATAACCACTGC

"Reverse": TATAtactagtagcggccgctgcagTTATGCTGATGCTGTCAAAG


Added 7/1/09 - Anusuya

  • TrpR (E. coli str. IAI1)

Forward: TATAgaattcgcggccgcttctagATGGCCCAACAATCACCCTATTCAGC

Reverse: 'TATAtactagtagcggccgctgcagTCAATCGCTTTTCAGCAACACCTCTTCCAGCCACTGGC


  • Trp Promoter and Operator (E. coli: no specified strain )

Forward: TATAgaattcgcggccgcttctagagCTCAAGGCGCACTCCCGTTCTG

Reverse: TATAtactagtagcggccgctgcagTCGATACCCTTTTTACGTGAACTTGCGTACTAG


  • Protease-binding sequence?


Gene Sequences

  • trp-operon (promoter-operator) sequence

5' CTCAAGGCGCACTCCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGACCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCAAGTTCACGTAAAAAGGGTATCCA 3'

(Nucleotide Sequence of the Promoter- Operator Region of the Tryptophan Operon of Escherichia coli By G. N. BENNETT, M. E. SCHW~,INGRUB~.R~, K. D. BROW~: C. SQUIRES § AND C. ¥'ANOFSKY )

  • HylB

ATGATCATCAATAAATTTTCCCTTAAATGGATGTTGGCTATTGCCGTCGCCATCCCTGCGATAGCACTGTTGTTTGTGGCTTTCACCAGTCTAAACACCATGTCAGTGATGCAAGCGCAGTCCAACAGCTTGTATGCCAACACGGCTGCACCAATGCGTGCCATGGCTGAAGCAACCTCACGTATTCCTCGGATGCGTGTCGGTATCGATATGATGCTACTGCAAGAAACGGCGCTCAAAGATGCGAAAGGGGTCCTCAAACGAGTCGAAGAGGCAAGAACCGAAGATATCCCAGAAATGCGTCAAGCAATGCAAGTTGCGGTTGATTCTCAGGTTAATCCGGAACTCAAAGAGCAGGCACGCAAACTTCAAGCTCGTTTTGAACAAATGGTACGTGAAGAGTTAGAGCCTATGCTGCAAGCCTTCGCCAATAACGATATGACCACGGCACAAAACATTTACCGCGATAAATACGCGCCGACCTATGGTGAAATGCGTAAACAAGCCAACCAGATCCTCGATACGCTTTTGCAGCAAGCGGAGCAGCAAAACCATGCCAGTGTGGAAAGCTTCGAAGCAGGACGCACCAAGCAAATGGTGATCATTGCAGCAGGCTTGATCATTTCATTCATCACTTCACTGGTTATCATAACGAACTTACGTAGCCGAGTGGCTTACCTGAAAGATCGTATGAGTTCTGCGGCGGCGAATCTTTCACTGCGTACTCGATTGGAGTTGGATGGTAACGATGAACTGTGTGACATCGGTAAAAGCTTCAATGCGTTCATTGATAAAGTGCATCACTCGATTGAAGAAGTGGCAGAAAACTCAAAAGAGCTGGCGACGATGGCCTCTAGTGTGTCGCAGCGCGCGCACATGACGCAATCTAACTGTGCTTCGCAGCGAGATAGAACAGTGCAAGTTGCGACGGCGATTCATGAGCTTGGTGCCACCGTATCCGAAATCGCTTCCAATGCGGCCATGGCTGCCGATGTCGCGAAGCAAGCGACGCTGCATTCTGGTGAAGGGAAAAAAGTGGTAGGCGAAGTGCAAAATCGGATCCAAACACTGGTCAATGAACTCGATAATGCCACTCAAGTTGTCTCATCACTGGCGACCCAAATTAACGGTATTAGCTCAACACTTGATACCATTCGCAGTATTTCTGAGCAAACGAACCTATTGGCGCTCAACGCTGCGATTGAAGCTGCGCGAGCGGGTGAACAAGGTCGTGGTTTTGCGGTGGTGGCGGATGAAGTTCGCACATTAGCAAGTCGTTCAGCGGCATCGACGGAAGAGATCCAGCAAGTCATTAATCGCCTTCAAACGGAGTCAACTCGCGCAGTAGAAGCAATGGAAAAAGGTCGCTCGCAAAGTGATGTGGTGGTTGAGTTTTCCGCTAAAGCGAACCAATCTCTCACAGAGATCAACAGCCAAATTGATCAGATTAATGATCAAAATATTCAAGTTGCGACCGCGACAGAGGAACAATCAACCGTGGTGGAAGACATTAATCGCAACGTTGAAGACATCAACCAACTGACGACAGAAACCTCGCATGTTGCGGATGAGTTAAGCCGAGCCAGTGCAAGCTTGCAACGTCTCTCTTCGCAACTGGATAAACTGGTGGGCAGTTTTGAACTTTAA http://www.ncbi.nlm.nih.gov/nuccore/NC_012583.1/?from=274978&to=276624&report=fasta NCBI Reference Sequence: NC_012583.1 from Vibrio cholerae O395 chromosome II, complete genome

  • HylD

ATGGCTGCGTTCGGACAAGACGTCTTCAGGCGCTTCGGCACGGTCACCGAACGCTTCTCCGGCACCGGCGGCAAACTCTTCGGCGGCCTGCTCGCGCGCCTGTCGAGCGTGGAGCGCGACGACAGCCTGGACTGGGCGAGCGACGCCGACTGGGCGCGCCTGCAGCAGGAGCCGCTGCGCGCGCGCGCGGTACTCAAGGTCAGCGCGATCGCGCTGCTGGTGCTGCTCGGCTGGGCCGCGGTGGCGCATGTGGACGAGGTGACCAAGGGCGACGGCAAGGTGATCCCGTCCAGCCAGCTGCAGATCATCCAGTCGGTCGATGGCGGCGTGGTGGAGTCGATCGCGGTGCGCGAGGGCGAGGTGGTCGAGGCCGGGCAGCTGCTGCTCAAGGTCGATCCCACCCGTTTCATGTCCTCGCTGCTGGAAAACCGCGCCGAGTTCCTCGCGCTGGAAATCAAGCGCCGGCGGCTCGAGGCGCTGACCCAGGGGACGCCGTTCTCGGTGCCGGCCGAGCTGGAGAAGGAGGCGGCGGACATCGCCGCCCACGAGCGCCGGCTGTATGAATCCAGCCGCGCCGAGATGGACGCGCAGCAGTCGATCGCGCGCGACCAGCTGCGCCAGCGCGAGCAGGAACTCAACGAGGTGCGCGCCCGCAGTGAGAACGCCGCCCGCGCCTACGAACTGGTGCAGCAGGAACTCAAGGTCACCAAGCCGCTCGCGGCCTCCGGCGCGGTATCCGAGGTCGAGCTGCTGCGTCTGGAGCGCGACGTGTCGCGCTTGCGCGGCGAGCGCGAGCAGAGCGCGGCGCAGATTTCGCGCATCCAGTCGGCCATCGCCGAATCCACGCGCAAGATCCAGGAGATCGAGCTGACGGTGCGCAACCAGCTGCGCAACGAGCTTTCGGACACCATGGCGCGGCTGGGCAGCCTGACCCAGGGCAGCCGCATGCTGGCCGACCGCGTCAAGCACGCCGAAATCCGCGCGCCGATGCGCGGCACGGTCAAGCGCATCCTCGTCAACACCGTGGGTGGCGTGGTCCAGCCGGGCAAGGAAGTGGCCGAGATCGTGCCGCTCGACGACGCGCTGATCCTCGAAGCGCAGGTCAAGCCGAGCGACATCGCCTTCCTGCGCCCGGGTCAGTCGGCGCTGGTCAAGTTCTCCGCGTACGACTTCTCGATCTACGGCGGCCTGGAGGCGGTCGTGGACCAGATTTCCGCCGACACCGTGGTCGATGCAAAGGGTTCCGCGTTCTACGTGGTGCGGGTGCGCACGCTGCATTCCTCTCTGGGTGAAAACCTGCCGATCATTCCGGGCATGGTGGCCGAAGTGGACATCCTGACCGGCAAGAAGACCATCCTCTCCTACCTGCTGAAGCCCGTGCTGCGGGCCAAGGCCAACGCACTGTCCGAACGATGA http://www.ncbi.nlm.nih.gov/nuccore/NC_008702.1/?from=674498&to=675913&report=fasta NCBI Reference Sequence: NC_008702.1 from Azoarcus sp. BH72, complete genome

  • TolC

ATGAAGAAATTGCTCCCCATTCTTATCGGCCTGAGCCTTTCTGGGTTCAGTTCGTTGAGCCAGGCCGAGAACCTGATGCAAGTTTATCAGCAAGCACGCCTTAGTAACCCGGAATTGCGTAAGTCTGCCGCCGATCGTGATGCTGCCTTTGAAAAAATTAATGAAGCGCGCAGTCCATTACTGCCACAGCTAGGTTTAGGTGCAGATTACACCTATAGCAACGGCTACCGCGACGCGAACGGCATCAACTCTAACGCGACCAGTGCGTCCTTGCAGTTAACTCAATCCATTTTTGATATGTCGAAATGGCGTGCGTTAACGCTGCAGGAAAAAGCAGCAGGGATTCAGGACGTCACGTATCAGACCGATCAGCAAACCTTGATCCTCAACACCGCGACCGCTTATTTCAACGTGTTGAATGCTATTGACGTTCTTTCCTATACACAGGCACAAAAAGAAGCGATCTACCGTCAATTAGATCAAACCACCCAACGTTTTAACGTGGGCCTGGTAGCGATCACCGACGTGCAGAACGCCCGCGCACAGTACGATACCGTGCTGGCGAACGAAGTGACCGCACGTAATAACCTTGATAACGCGGTAGAGCAGCTGCGCCAGATCACCGGTAACTACTATCCGGAACTGGCTGCGCTGAATGTCGAAAACTTTAAAACCGACAAACCACAGCCGGTTAACGCGCTGCTGAAAGAAGCCGAAAAACGCAACCTGTCGCTGTTACAGGCACGCTTGAGCCAGGACCTGGCGCGCGAGCAAATTCGCCAGGCGCAGGATGGTCACTTACCGACTCTGGATTTAACGGCTTCTACCGGGATTTCTGACACCTCTTATAGCGGTTCGAAAACCCGTGGTGCCGCTGGTACCCAGTATGACGATAGCAATATGGGCCAGAACAAAGTTGGCCTGAGCTTCTCGCTGCCGATTTATCAGGGCGGAATGGTTAACTCGCAGGTGAAACAGGCACAGTACAACTTTGTCGGTGCCAGCGAGCAACTGGAAAGTGCCCATCGTAGCGTCGTGCAGACCGTGCGTTCCTCCTTCAACAACATTAATGCATCTATCAGTAGCATTAACGCCTACAAACAAGCCGTAGTTTCCGCTCAAAGCTCATTAGACGCGATGGAAGCGGGCTACTCGGTCGGTACGCGTACCATTGTTGATGTGTTGGATGCGACCACCACGTTGTACAACGCCAAGCAAGAGCTGGCGAATGCGCGTTATAACTACCTGATTAATCAGCTGAATATTAAGTCAGCTCTGGGTACGTTGAACGAGCAGGATCTGCTGGCACTGAACAATGCGCTGAGCAAACCGGTTTCCACTAATCCGGAAAACGTTGCACCGCAAACGCCGGAACAGAATGCTATTGCTGATGGTTATGCGCCTGATAGCCCGGCACCAGTCGTTCAGCAAACATCCGCACGCACTACCACCAGTAACGGTCATAACCCTTTCCGTAACTGA http://www.ncbi.nlm.nih.gov/nuccore/NC_000913.2/?from=3176137&to=3177618&report=fasta NCBI Reference Sequence: NC_000913.2 from Escherichia coli str. K-12 substr. MG1655, complete genome



  • Protease-binding sequence?

Anti-Inflammatory Device

Primers:


SoxR (Escherichia coli E24377A)

Forward: TATAgaattcgcggccgcttctagATGGAAAAGAAATTACCCCGC

Reverse: TATAtactagtagcggccgctgcagTTAGTTTTGTTCATCTTCCAGCAAGCGTG

complete gene sequence: [2]

SoxS promoter (Joe 7-5)

Forward: TATAgaattcgcggccgcttctagagAATCGCTTTACCTCAAGTTAACTTG

Reverse: TATAtactagtagcggccgctgcagCAGTTCGTTAATTCATCTGTTGGG


Added 7/1/09 - Anusuya

CrtB (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctagATGGCAGTTGGCTCGAAAAG

Reverse: TATAtactagtagcggccgctgcagCTAGAGCGGGCGCTGCCAG


CrtE (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctagATGACGGTCTGCGCAAAAAAAC

Reverse: TATAtactagtagcggccgctgcagTTAACTGACGGCAGCGAGTTTTTTG


CrtI (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctag ATGAAACCAACTACGGTAATTGGTGC

Reverse: TATAtactagtagcggccgctgcag TGATTGAGTAACGACGG


CrtY (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctag ATGCAACCGCATTATGATCTG

Reverse: TATAtactagtagcggccgctgcag TTAACGATGAGTCGTCATAATGGC


Soxs: primer dimers


Blh (uncultured marine bacterium 66A03)

Forward: TATAgaattcgcggccgcttctagATGGGTCTGATGCTGATTG

Reverse: TATAtactagtagcggccgctgcagTCAGTTTTTGATTTTGATACGGG


RalDH(II) (Rattus Norvegicus*)

Forward: TATAgaattcgcggccgcttctagATGCCCGGCGAGGTGAAGGC

Reverse: TATAtactagtagcggccgctgcagTTAGGAGTTCTTCTGGGGGATC

  • Originally from Rattus Norvegicus but sequence was modified

HlyR: Since HlyR is not a protein. This sequence is sequenced as a chunk with HlyA,HlyB, HlyC. Thus only one primer is needed. primer: TATAtactagtagcggccgctgcagGAATTCCAAGCGAAGTCC

check paper for RalDH(II) http://www.jbc.org/cgi/content/abstract/271/27/16288

Gene sequences: SoxR ATGGAAAAGAAATTACCCCGCATTAAAGCGCTGCTAACCCCCGGCGAAGTGGCGAAACGCAGCGGTGTGGCGGTATCGGCGCTGCATTTCTATGAAAGTAAAGGGTTGATTACCAGTATCCGTAACAGCGGCAATCAGCGGCGATATAAACGTGATGTGTTGCGATATGTTGCAATTATCAAAATTGCTCAGCGTATTGGCATTCCGCTGGCGACCATTGGTGAAGCGTTTGGCGTGTTGCCCGAAGGGCATACGTTAAGTGCGAAAGAGTGGAAACAGCTTTCGTCCCAATGGCGAGAAGAGTTGGATCGGCGCATTCATACCTTAGTGGCGCTGCGTGACGAACTGGACGGATGTATTGGTTGTGGCTGCCTTTCGCGCAGTGATTGCCCGTTGCGTAACCCGGGCGACCGCTTAGGAGAAGAAGGTACCGGCGCACGCTTGCTGGAAGATGAACAAAACTAA http://www.ncbi.nlm.nih.gov/nuccore/NC_009801.1/?from=4616553&to=4617017&report=fasta (NCBI Reference Sequence: NC_009801.1 from Escherichia coli E24377A, complete genome)

SoxS

AATCGCTTTACCTCAAGTTAACTTGAGGAATTATACTCCCCAACAGATGAATTAACGAACTG


Crt genes GenBank accession no. D90087—should we do as the entire cluster (in this case how should we design primers) or in parts?

Blh ATGGGTCTGATGCTGATTGATTGGTGTGCACTGGCTCTGGTTGTTTTCATTGGCCTGCCGCACGGCGCGCTGGATGCTGCCATTTCTTTTTCTATGATCTCTTCTGCAAAACGCATTGCTCGTCTGGCTGGTATTCTGCTGATCTATCTGCTGCTGGCGACCGCGTTCTTCCTGATCTGGTATCAGCTGCCAGCGTTTAGCCTGCTGATCTTCCTGCTGATCTCCATTATCCACTTTGGTATGGCAGACTTCAACGCGTCCCCAAGCAAACTGAAATGGCCGCATATCATCGCCCACGGCGGTGTTGTTACTGTTTGGCTGCCGCTGATCCAGAAAAACGAAGTAACTAAACTGTTTAGCATCCTGACTAACGGTCCGACTCCGATCCTGTGGGACATCCTGCTGATTTTCTTCCTGTGTTGGTCTATTGGCGTGTGTCTGCACACGTACGAAACCCTGCGCTCTAAACATTACAACATCGCCTTTGAACTGATCGGTCTGATTTTCCTGGCGTGGTATGCGCCGCCTCTGGTTACGTTTGCCACTTACTTCTGCTTCATTCATTCCCGTCGCCACTTCTCCTTTGTGTGGAAGCAGCTGCAACACATGTCTTCCAAAAAGATGATGATTGGCAGCGCGATTATCCTGTCCTGTACCTCTTGGCTGATCGGCGGTGGTATCTATTTCTTCCTGAACTCCAAAATGATCGCCTCTGAGGCTGCGCTGCAGACTGTGTTCATCGGTCTGGCGGCACTGACCGTGCCGCACATGATTCTGATCGACTTCATCTTCCGTCCGCACTCTTCCCGTATCAAAATCAAAAACTGA

Kim et al. In vitro characterization of a recombinant Blh protein from an uncultured marine bacterium as a beta-carotene 15,15'-dioxygenase. J Biol Chem. 2009 Jun 5;284(23):15781-93. (supplementary material; 15,15'-Dioxygenase, product of Blh gene, codon-optimized and expressed in E. coli, forms a 64k protein of two 32 kDa dimers)

RALDH


HlyR:

sequence: GAATTCCAAGCGAAGTCCATCCCCCTCCCTCTTGATTACAAGGGTGATAATTATTATTCGCATTTGTGTG GTAATGGGATAGAAAGGAATGGATAGAAAAAGAACAAAATTAGTATAGCAATAGATATGCCCACTGCATT GAATACTTACAGGGCATTATTTTATTATGTTTAAATTGAAGTGGTCTCTGGTTTGATTTATTTGTTATTC AAGGGGGCTGTTTGGAGATCGGAAAATTCTGTACGTTAAGTGTATTATTTAACCAGTTTCGATGCGTAAC AGATTGATTTTGCTCAGCGGTTATCGCTTTTAAGTTGTTGCTCTTGGCTATCGCGTTTAGGTTATCCGAT TAAAGTCAAATTTCCTGAAAATGCTGTATAGCGCGGGAGTGCACCTTATAGCTGTAGGTAAGTATGTTCA AAAAATAGTCTTGCCGTACAATAATTTTCCATATCCAAACTCACTCCTTCAAGATTCTGGTCCCGGTTTA CGGGTAGTTTCCGGAAGGGCGGTAGCATGCTGATTCAAACTGCAAGATGAAACATTGTCGGAGTTGGATG GAATTAAGTCATGGCTATAGCATTTGGGCGTGCATAACAAAATTGGTCCTCATATTTTAGAGTATGATTG CATATTCACTAATATTTTTACTTTCTGATGCGTGGTGGCATCATGCTTTATGAGATAAACAATCCTGG

blh

ATGGGTCTGATGCTGATTGATTGGTGTGCACTGGCTCTGGTTGTTTTCATTGGCCTGCCGCACGGCGCG CTGGATGCTGCCATTTCTTTTTCTATGATCTCTTCTGCAAAACGCATTGCTCGTCTGGCTGGTATTCTG CTGATCTATCTGCTGCTGGCGACCGCGTTCTTCCTGATCTGGTATCAGCTGCCAGCGTTTAGCCTGCTG ATCTTCCTGCTGATCTCCATTATCCACTTTGGTATGGCAGACTTCAACGCGTCCCCAAGCAAACTGAAA TGGCCGCATATCATCGCCCACGGCGGTGTTGTTACTGTTTGGCTGCCGCTGATCCAGAAAAACGAAGTA ACTAAACTGTTTAGCATCCTGACTAACGGTCCGACTCCGATCCTGTGGGACATCCTGCTGATTTTCTTC CTGTGTTGGTCTATTGGCGTGTGTCTGCACACGTACGAAACCCTGCGCTCTAAACATTACAACATCGCC TTTGAACTGATCGGTCTGATTTTCCTGGCGTGGTATGCGCCGCCTCTGGTTACGTTTGCCACTTACTTC TGCTTCATTCATTCCCGTCGCCACTTCTCCTTTGTGTGGAAGCAGCTGCAACACATGTCTTCCAAAAAG ATGATGATTGGCAGCGCGATTATCCTGTCCTGTACCTCTTGGCTGATCGGCGGTGGTATCTATTTCTTC CTGAACTCCAAAATGATCGCCTCTGAGGCTGCGCTACAAACTGTGTTCATCGGTCTGGCGGCACTGACC GTGCCGCACATGATTCTGATCGACTTCATCTTCCGTCCGCACTCTTCCCGTATCAAAATCAAAAACTGA


RALDH II

ATGCCCGGCGAGGTGAAGGCCGACCCCGCCGCGCTCATGGCCTCGCTGCAGCTCCTGCCG TCACCCACGCCCAACCTCGAGATCAAGTACACCAAGATCTTTATTAACAATGAATGGCAG AACTCAGAGAGTGGGAGAGTGTTCCCTGTCTGTAATCCAGCCACAGGAGAGCAAGTGTGT GAAGTTCAAGAAGCAGACAAGGTGGATATAGACAAGGCAGTGCAGGCGGCCCGCCTGGCC TTCTCTCTTGGTTCTGTGTGGAGAAGGATGGACGCTTCTGAAAGAGGACGTCTGCTGGAC AAGCTTGCAGACTTGGTGGAACGGGACAGGGCAACTCTTGCAACTATGGAATCACTAAAT GGCGGTAAGCCATTCCTGCAAGCTTTTTACATCGATTTGCAGGGAGTCATCAAAACCCTG AGGTATTATGCAGGCTGGGCTGATAAAATTCACGGAATGACCATTCCTGTAGATGGAGAC TATTTTACCTTCACGAGACATGAGCCCATCGGAGTGTGTGGACAGATTATCCCGTGGAAT TTCCCCCTGCTGATGTTCACCTGGAAAATTGCTCCCGCACTGTGCTGTGGTAACACTGTG GTCATCAAGCCTGCAGAGCAGACACCACTCAGTGCACTGTATATGGGAGCCCTCATCAAG GAGGCTGGCTTTCCACCCGGGGTCGTCAACATTCTGCCAGGGTATGGGCCAACAGCAGGG GCAGCAATAGCGTCTCACATTGGCATAGACAAGATTGCATTCACAGGCTCTACTGAGGTT GGAAAGCTTATTCAAGAAGCAGCTGGAAGAAGTAATTTGAAGAGAGTAACTCTGGAACTT GGAGGGAAAAGCCCTAATATTATTTTTGCAGATGCTGACTTGGACTACGCTGTGGAGCAG GCTCACCAGGGTGTGTTCTTCAACCAAGGCCAGTGCTGCACTGCGGGGTCTCGAATCTTT GTGGAGGAGTCCATCTATGAGGAATTTGTGAAAAGAAGTGTGGAAAGAGCCAAGAGGCGC ATTGTGGGGAGCCCCTTTGATCCCACTACTGAGCAGGGTCCTCAGATTGATAAGAAGCAA TACAACAAAATCCTGGAGCTCATCCAGAGCGGTGTGGCCGAGGGCGCCAAGCTCGAGTGT GGAGGCAAAGGACTGGGAAGGAAGGGCTTCTTCATTGAGCCTACCGTGTTCTCCAACGTT ACAGATGACATGCGGATCGCCAAGGAGGAGATCTTTGGTCCTGTCCAGGAAATTTTGAGG TTTAAGACTATGGATGAAGTTATAGAAAGAGCCAATAACTCAGACTTCGGGCTTGTAGCG GCTGTCTTCACTAATGACATCAACAAGGCTCTCATGGTGTCCTCTGCAATGCAAGCTGGG ACAGTTTGGATCAATTGTTACAACGCCTTAAATGCTCAGAGCCCCTTCGGGGGGTTCAAG ATGTCTGGAAATGGGAGAGAAATGGGTGAGTTTGGCTTACGGGAGTACTCAGAAGTAAAG ACCGTGACGGTGAAGATCCCCCAGAAGAACTCCTAA

Comments

  • For gene sequencing, I would suggest genedesigner
  • For primer design and selection I would suggest APE and oligo 6.87
Personal tools